Nick regularly followed the Morris Dance Discussion List--the MDDL. His contributions--about 200 of them--show his wit and his knowledge of music, morris, and the Jeffries concertina. Here they are, as taken from the MDDL's archives.
Jim Voorhees
_________
Subject: Re: MORRIS Digest - 11 Jun 2006 to 12 Jun 2006 - Special issue (#2006-188)
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Mon, 12 Jun 2006 18:27:59 -0400
Content-Type: multipart/alternative
Kit aside, I really don't think all men's Cotswold sides exhibit
'vigor and grace.'
And I'm equally sure not all women's Cotswold sides are 'galumphing
and girly'.
Oh, wait. Never mind.
Nick Robertshaw
On Jun 12, 2006, at 2:34 PM, MORRIS automatic digest system wrote:
> For Cotswold, I agree that it takes more effort to achieve a
> unified look so
> that dancers of each sex pick up the strengths of the opposite one,
> rather than
> emphasising the weaknesses of their own (ie achieving both vigour
> and grace,
> while avoiding the galumphing and the girly). It can be done, but
> differentiated kit makes it impossible.
________
Subject: Re: MORRIS Digest - 26 May 2006 to 27 May 2006 (#2006-170)
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Sun, 28 May 2006 21:22:17 -0400
Content-Type: multipart/alternative
Parts/Attachments:
No. It's not extinct.
Its DNA is still out there.
On May 28, 2006, at 12:00 AM, MORRIS automatic digest system wrote:
>
> Now if only someone could explain to my wife that my membership of the
>
> now extinct (..or is it.. no one has actually said so!) Herga Morris
>
> coupled with my non-membership of Non-existent Morris entirely justifies
>
> my behaviour of just sitting at home drinking beer and reminiscing about
>
> half-galleys and Trunkles on at least two nights a week.
>
>
_________
Subject: Noun of venery for tabor-pipes
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 10 May 2006 18:04:41 -0400
>
The frank description should be a jet of whittles.
Nick Robertshaw
Fog, Rat Squeezer
> From: Jenny Howard <jehoward@SUREFISH.CO.UK>
> Date: May 9, 2006 8:08:01 AM EDT
> Subject: Re: Collective music
>
>
>>> Ha!- just because you play pipe and tabor Steve:-)) (so what's the
>>> collective noun for them - or do you ever get more than one at a time?)
>
> Don't they come under the old Scottish term 'a kissed of whistles' ... or am I
> getting even more confused than usual? ;-)
>
> Jenny H
> :^)
> o
________
Subject: Re: MORRIS Digest - 5 Apr 2006 to 6 Apr 2006 (#2006-107)
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Fri, 7 Apr 2006 09:30:43 -0400
Content-Type: text/plain
>
> 1. never cast a clout til May is out (7)
> 6. Casting clouts!
>
The 'clout' refers to 'cloth'.
c.f.
"||: I saw the man in the moon (fie man, fie) :||
Clouting off St Peter's shoon"
Once May is out, Dwile Flonking season commences, so the clouts can
be cast.
Currently, May is very much in the closet. Once she admits to what we
already know, that she and June are indeed hot lesbian lovers,
Flonking can begin.
I plan to rent the video.
Nick
4mer 4 FBMM
________
Subject: San Francisco May Day
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Sat, 25 Mar 2006 22:29:36 -0500
Content-Type: text/plain
Hi:
I am going to be in San Fran on May 1 and am interested in joining a
local side for dawn dance. I will bring kit and concertina if anyone
needs an extra muso (loud Jeffries duet concertina, 35 year's
experience)
email me offlist.
Nick Robertshaw
Foggy Bottom Morrismen, etc.
________
Subject: Kirtlington Lamb Ale
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 21 Jun 2000 14:07:38 -0400
Content-Type: text/plain
Does anyone have a good recipe? I keep getting too much mutton fat floating
on the surface (even after cask conditioning) and this masks the bouquet of
hops and mint sauce.
--
Nick Robertshaw
________
Subject: Re: Sherborne
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 14 Jun 2000 14:41:01 -0400
Content-Type: text/plain
Norman poured the following metaphor into his Kitchen Aid:
>
> (Where would we be if we couldn't stand on the shoulders of the giants of
> morris research like Roy Judge, and look out over vast and fresh vistas?
> Re-inventing the wheel, I suppose.)
>
Well if the chips were down I'm sure you'd know which side your bread was
buttered.
Nick
________
Subject: Re: Horn Dance
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Sat, 10 Jun 2000 13:55:17 -0400
Content-Type: text/plain
I think you mean:
"W7ucyBvZ"
unless you are using Hamilton's notation, which is of course totally
anachronistic for Abbots Brommley.
--
Nick Robertshaw
ParaGlyph. 301 694 8604
http://www.paraglyph.com
----------
>From: Teri Davis <dragonct@IX.NETCOM.COM>
>To: MORRIS@LISTSERV.IUPUI.EDU
>Subject: Horn Dance
>Date: Sat, Jun 10, 2000, 3:04 AM
>
> SSd2ZSBuZXZlciBiZWVuIGZvcnR1bmF0ZSBlbm91Z2ggIHRvIHNlZSB0aGUgYXV0aGVudGljDQpB
> YmJvdHMgQnJvbWxleSBIb3JuIERhbmNlIChhbHRob3VnaCBJJ3ZlIHNlZW4gbWFueQ0Kc3RpbGwg
> cGhvdG9zIG9mIGl0LCAgdGFrZW4gYnkgbXkgZXgtd2lmZSwgd2hvIGZvbGxvd2VkDQp0aGVtIGFs
> bCBkYXkgYmFjayBpbiB0aGUgNzAncykgYnV0IEkgaGF2ZSBzZWVuIGFuZCBldmVuDQpkYW5jZWQg
> aW4gdmFyaW91cyB2ZXJzaW9ucyBvZiBpdCBoZXJlIG9uIHRoZSBXZXN0IENvYXN0DQpvZiBOb3J0
> aCBBbWVyaWNhLiAgIEZvciBhdCBsZWFzdCAyNSB5ZWFycyB0aGUgUGlwZSBhbmQNCkJvd2wgTW9y
> cmlzIE1lbiBoYXZlIGRvbmUgdGhpcyBldmVyeSBTYXQuICYgU3VuLiBmb3INCnRoZSA2IHRvIDgg
> d2Vla2VuZHMgb2YgdGhlIE5vcnRoZXJuIENhbGlmb3JuaWEgUmVuYWlzc2FuY2UgRmFpcmUuICBU
> aGV5IGhhdmUgNiBzZXRzIG9mIGRlZXIgYW50bGVycw0Kd2l0aCBhIHBhcGllci1tYWNoZSAoSSB0
> aGluaykgZGVlciBoZWFkIGFkZGVkIHVuZGVyDQp0aGVtIHdpdGggYSBzaG9ydCBzdGljayB1bmRl
> ciBpdCB0byBob2xkIGl0IGJ5LiAgVGhleQ0KcHJvY2VzcyBpbiBhIHNvbGVtbiAmIHN0YXRlbHkg
> bWFubmVyIHRocm91Z2ggdGhlIHdob2xlDQpsZW5ndGggb2YgdGhlIGZhaXIuICBUaGUgRmFpcmUg
> aXMgYWxzbyBvcGVuIG9uIExhYm9yIERheQ0KTW9uZGF5LCBhbmQgSSByZWNhbGwgb25lIHRpbWUg
> c29tZSB5ZWFycyBhZ28sIHdoZW4NCnRoYXQgaGFwcGVuZWQgb24gU2VwdC4gNiBvciA3LCAgdGhh
> dCBvbmUgb2YgdGhlIGRhbmNlcnMNCnJlbWFya2VkIHRvIG1lIHdpdGggZ3JlYXQgcGxlYXN1cmUg
> dGhhdCBpdCB3YXMgdGhlIHZlcnkNCnNhbWUgZGF5IHRoZSBkYW5jZSB3YXMgaGFwcGVuaW5nIGlu
> IEFiYm90cyBCcm9tbGV5Lg0KICBBdCBhbiBldmVuaW5nIGNhbXBmaXJlIGEgZmV3IHllYXJzIGFn
> byBhdCBFbmdsaXNoIFdlZWsgYXQgTWVuZG9jaW5vIFdvb2RsYW5kcyAoYSBkYW5jZSBjYW1wIGlu
> IENhbGlmb3JuaWEpLCAgYSBncm91cCBvZiBob3JuIGRhbmNlcnMgYXBwZWFyZWQgb3V0IG9mDQp0
> aGUgZGFya25lc3MsIGRhbmNlZCBieSB0aGUgZmlyZWxpZ2h0LCB0aGVuIHZhbmlzaGVkIGludG8N
> CnRoZSB3b29kcyBhZ2Fpbi4gIFRoaXMgd2FzIGFsc28gc2xvdyAmIHN0YXRlbHkuDQogIEluIGNv
> bnRyYXN0LCAgd2hlbiBJIHdlbnQgdG8gS2lsbGVyICdBbGUgSUlJIG5lYXIgU2VhdHRsZQ0KaW4g
> MTk4NiB3aXRoIHRoZSBsYXRlIFRlcnJ5IE8nTmVhbCBhbmQgSm9jZWx5biBSZXlub2xkcw0KKHdl
> IHdlcmUgdGhlIHdob2xlIEJlcmtlbGV5IE1vcnJpcyBjb250aW5nZW50KSwgDQpIb2xseSBUcmVl
> IE1vcnJpcyAoYSBtaXhlZCB0ZWFtIGZyb20gVmljdG9yaWEsIEJyaXRpc2gNCkNvbHVtYmlhLCBh
> bmQgLSBJIHRoaW5rIC0gdGhlIG9ubHkgbW9ycmlzIHRlYW0gb2xkZXINCnRoYW4gQmVya2VsZXkg
> aW4gdGhlIHdlc3Rlcm4gb25lLXRoaXJkIG9mIE4uIEFtZXJpY2EpDQpkaWQgYSB2ZXJzaW9uIG9m
> IHRoZSBIb3JuIERhbmNlIGFzIHRoZWlyIHNob3cgZGFuY2UgYXQNCnRoZSBtYXNzIHB1YmxpYyBn
> YXRoZXJpbmcuICBUaGV5IGhhZCA4IGRhbmNlcnM6ICA2IHdpdGgNCmFudGxlcnMsIHBsdXMgaG9i
> YnkgaG9yc2UgJiBhcmNoZXIgKFJvYmluIEhvb2Q/KS4NClRoZXkgcmVjcnVpdGVkIEpvY2VseW4g
> YXMgZm9vbCAoc3VwcGxpZWQgd2l0aCBtb3RsZXkNCmdhcmIpIGFuZCBUZXJyeSBhcyB0aGUgQmV0
> IChNYWlkIE1hcmlhbj8pICAtIHRoZXkNCmZ1bGx5IGVxdWlwcGVkIGhpbSB3aXRoIGRyZXNzLCBw
> dXJzZSwgZXRjLg0KVGhlaXIgZGFuY2Ugd2FzIHF1aWNrIGFuZCBzcHJpZ2h0bHkgIC0gIGEgdmVy
> eSBkaWZmZXJlbnQNCmZlZWwgZnJvbSBvdGhlciB2ZXJzaW9ucyBJIGhhZCBzZWVuLiAgKElzIHRo
> YXQgaG93IHRoZQ0KZ2VudWluZSBBYmJvdHMgQnJvbWxleSBtZW4gZG8gaXQ/KQ0KICBBbHNvLCBh
> IGZldyB5ZWFycyBhZ28gYSB3b21hbiB0aGVuIHdpdGggQmVya2VsZXkNCk1vcnJpcyBnb3QgMTIg
> cGFpciBvZiBhbnRsZXJzIG1vdW50ZWQgb24gcG9sZXMgYWJvdXQNCjQgb3IgNSBmZWV0IGxvbmcu
> ICBTaGUgdGF1Z2h0IHRoZSBkYW5jZSAoYXMgc2hlIGludGVycHJldGVkDQppdCBmcm9tIHNvbWUg
> d3JpdHRlbiBzb3VyY2UpIHRvIG1hbnkgb2YgaGVyIGZyaWVuZHMsIA0KaW5jbHVkaW5nIHNvbWUg
> d2hvIGRpZCBubyBvdGhlciBkYW5jZS4gICBXZSBkaWQgaXQgYXQNCjU6MzAgQU0gaW4gdGhlIGRh
> cmsgb24gTWF5IDEgYSBjb3VwbGUgb2YgeWVhcnMsIGp1c3QNCmJlZm9yZSB0aGUgZmlyc3QgY290
> c3dvbGQgbW9ycmlzIGRhbmNlIGZvciB0aGUgdXN1YWwNCnRocm9uZyBvZiAxNTAgb3Igc28gaGFy
> ZHkgc291bHMgd2hvIGdhdGhlciBvbiB0aGF0DQp3aW5keSByaWRnZSBhdCB0aGF0IGFic3VyZGx5
> IGVhcmx5IGhvdXIgZXZlcnkgeWVhci4NClNoZSBsZWZ0IHRoZSB0ZWFtICYgdG9vayBoZXIgaG9y
> bnMgd2l0aCBoZXIuICBIb3dldmVyLA0KSSBoYXZlIGFjcXVpcmVkIDYgc2V0cyBvZiBhbnRsZXJz
> IGFuZCBzb21lZGF5IEkgbWF5IGdldA0KdGhlbSBtb3VudGVkIGluIGEgd2F5IHRvIGJlIHVzYWJs
> ZS4gICBEb24ndCBrbm93IA0KanVzdCBob3cgSSdkIHdhbnQgdG8gZG8gdGhlIGRhbmNlLCB0aG91
> Z2gsIGlmIGl0IHdhcw0KbXkgY2hvaWNlLg0KICAtIEJvYiBPcnNlcg0KICAgIChCZXJrZWxleSBN
> b3JyaXMsIE5vcnRvbidzIEd1YXJkIExvbmdzd29yZCwNCiAgICAgIGFuZCBmb3JlbWFuIG9mIEJs
> dWUgUm9zZSBNb3JyaXMgJiBTd29yZA0KICAgICAgaW4gdGhlIFNDQSBCYXJvbnkgb2YgRGFya3dv
> b2QpDQogIChvbiB3aWZlLCBUZXJpIERhdmlzJyBlLW1haWwgYWNjdC4pDQoNCg==
>
________
Subject: Re: Royal Doulton promoting Morris
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Thu, 4 May 2000 09:42:03 -0400
Content-Type: text/plain
Some long-haired ballad singer is going to sign a few tasteless china
rabbits and this will be good for Morris in America?
Why not have a few morris dancers signed by Brittney Spears to promote the
Kitsch Figurine industry?
What? Doulton not Bolton?
nevermind
--
Bignick
fbmm 4mn
----------
>From: "A.S.Miller" <ke6seh@EARTHLINK.NET>
>To: MORRIS@LISTSERV.IUPUI.EDU
>Subject: Royal Doulton promoting Morris
>Date: Thu, May 4, 2000, 4:16 AM
>
> For fear of contributing to what feels like the start of a flame
> war, let me say a few things about the American Morris/Royal Doulton
> Bunnykins Morris Dancer cross-promotion:
>
> First, **I** approached Royal Doulton - it wasn't the other way
> round.
>
> Second, as someone stated, Morris is not well known in America - and
> certainly not as well known as, say, Royal Doulton.
>
> Third, I believe that dancing in a public venue with a corporate
> sponsor as visible as Royal Doulton can only lend credibility to our
> performance, and give us increased visibility.
>
> Fourth, Royal Doulton has paid P.R. people - so why not use
> resources that can help promote Morris Dance in America if we don't
> have to do much more than just show up for a gig?
>
> Fifth, with only 12 Bunnykins Morris Dancers per store, R.D. is not
> expecting to make enough to pay for Michael Doulton's travel
> expenses on this. Most people are gonna come to the R.D. stores
> because they are gonna want to meet Michael Doulton, and have him
> autograph a collectible piece on the chance that it will enhance the
> value (either monetary value, and/or sentimental value) - not
> because there will be Morris Dancers there - and anyone who thinks
> otherwise is just fooling themselves.
>
> Sixth, if the truth be known, we will probably receive more value
> from R.D.'s sponsorship than R.D. will receive from our
> participation, even though R.D. probably perceives equal or greater
> value from our presence - which is why this deal can be made to
> happen, in the first place. Truthfully, this concept is so young,
> there is still a chance that it might not happen. However, at this
> point, it is probably up to us to make it happen more than it is
> likely that Royal Doulton doesn't want this to happen.
>
> Seventh, if we help support this series of special events, is there
> a chance that we might be able to further influence R.D. -- can you
> see another limited edition for 2001 - Bunnykins Morris Musician
> (with melodeon)? What about a series of R.D. figurines that are
> based on real life HUMAN Morris Dancers? What a blast to have the
> tail wag the dog!
>
> Eighth, it didn't occur to me, originally, but yes, isn't there a
> chance that another gig could grow out of a local performance at an
> R.D. store -- after all, a lot of the people who buy R.D.
> collectibles have some real money, and might like a Morris team to
> perform at a wedding, an anniversary, or other special event? The
> Figs have gotten paid for entertaining at large corporate parties
> from this kind of public exposure.
>
> Ninth, the fact that R.D. is featuring a MORRIS DANCING BUNNYKINS as
> only one of two SPECIAL EVENT FEATURED FIGURINES FOR THE WHOLE of
> 2000 says a whole lot to me about the significance of Morris Dancing
> to some who are English. Cute isn't necessarily bad. When placed
> against the context of an actual Morris performance, we can provide
> some balance in the presentation of Morris to the American public.
> Do you want the cute bunny to be the only impression of Morris to
> which these folks are exposed.
>
> Tenth, since when is commercial sponsorship a bad thing? Moreton Bay
> Fig Morris receives contributions from a brewery, which is a
> commercial operation. We lend them some of our presence and
> attitude, and they contribute their resources. How many of your
> teams have also benefited from a relationship with a commercial
> entity? I know of a team that received a benefit from a relationship
> with the company that makes SPAM (of all things).
>
> Eleventh, must we take ourselves SO SERIOUSLY that we can't have fun
> with this cross promotional opportunity, and take advantage of a
> company that needs us more than we need them?
>
> Twelfth, and finally, the specific amount that will be contributed
> for each performance has yet to be established, but wouldn't it be
> nice if R.D. was willing to contribute $200 for several short
> performances over a four hour afternoon period? Not bad money to
> benefit a non-profit group for a fun gig with a virgin audience.
> And, R.D. has deep pockets, and is likely to be able to afford to
> pay this kind of performance fee, don't you think?
>
> Hopefully this has provided some additional perspective.
>
> Now, for everyone who understands what I am saying, and who has an
> opportunity and a wish to participate at a location near you, you
> can contact me off list at the email address or phone number
> provided in my original posting.
>
________
Subject: FW: abandoning my Morris Pages on the Web listing
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Thu, 6 Apr 2000 09:10:47 -0400
Content-Type: text/plain
Jeff:
How about putting in a field on the form for 'logo URL' and asking
submitters to put a, say 200 x 200 pixel logo on their own web server? Your
form-generated html could then incorporated it. Those who can will and those
who can't will have a torn ? or an X
--
Nick Robertshaw
ParaGlyph. 301 694 8604
http://www.paraglyph.com
>
>
> ----------
>>From: Jeff Bigler <jcb@MIT.EDU>
>>To: MORRIS@LISTSERV.IUPUI.EDU
>>Subject: Re: abandoning my Morris Pages on the Web listing
>>Date: Wed, Apr 5, 2000, 2:49 PM
>>
>
>> Thanks for all the congratulatory messages, and for the messages
>> expressing support for the web site.
>>
>> I've given the matter some more thought. While I enjoyed having the
>> logos on the page (and believe it or not, I also enjoyed the challenge
>> of making each one look as reasonable as I could in a reduced size, and
>> with reduced colors), those were by far the biggest time sink. (The web
>> form automatically formats the information in HTML for my page, Rich
>> Holmes's page and John Maher's page, so there was no need to spend time
>> formatting the rest of the information. I've left the form in place for
>> Rich's and John's benefit.)
>>
>> If I gave up on the logos, and if I reorganized my web directory so it
>> was possible to automate the inclusion of each piece, I could probably
>> make it require little enough of my time to be able to keep up with it.
>> (I've been helping my wife do this with a web site she maintains, and
>> it's given me some good ideas.)
>>
>> I also realized (thanks to those of you who pointed it out) that the
>> contact info I was collecting was more useful than I had been giving it
>> credit for, which is another reason for not abandoning the idea
>> altogether. If I were to redesign the form so that it also included
>> practice night, tradition/style, and kit description, and if I also
>> included entries for sides that don't have web pages, the page would be
>> a legitimate replacement for the lamented American Morris Newsletter's
>> annual directory of sides, and could also become the morris spotter's
>> guide some of you have been wishing for, with almost all of the work
>> required being put in up front.
>>
>> If I do manage to reorganize things, I'll reinstate the modified page
>> (sadly, without logos), and I'll probably ask people on this list to
>> resubmit info for their sides, to make sure everything is as complete
>> and up-to-date as possible. With a little luck, I should be able to
>> have the site in good shape and much more maintainable by the time the
>> baby is born in July.
>>
>> Watch this space for details.
>>
>> Jeff Bigler
>>
________
Subject: Re: Odes to Joy
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Sat, 11 Mar 2000 11:13:56 -0400
Content-Type: text/plain
This was one of the theme songs of a Bath-City-Morris-Extended tour of the
Letterkenny (IRL) Festival back in the early 70s. Tubby, John Forrest, Geoff
Hughes and myself were there. I can't remember who brought the song. It
might have been me, in which case I learned it from Hairy (Richard Remmer).
--
Nick Robertshaw
----------
>From: Chris Bartram <chris_bartram@COMPUSERVE.COM>
> My favoutite set of words to the OtJ came from the label of the Guinness
> bottle used by English 'Trade' bottlers in the '60s
> ;
> Arthur Guinness, Son and Company
> Park Royal Limited, Brewers
> Extra Stout, Registered Trademark
> Guiness, Arthur Guinness
> Bottled by Allied Breweries (UK) Limited
> Burton on Trent
> Registered Trademark, Nine-and-two-thirds-fluid-ounces
> Dublin and London.
>
> The Morris content is that I believe I first heard this sung by John
> Forrest (yes, _that_ John Forrest). If it wasn't John Forrest, then it wa=
> s
> probably John Walker. =
>
>
> Come to think of it, there's an awfull lot of brewing history in that
> label.
________
Subject: Re: Flags(no mc, flame potential)
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Mon, 6 Mar 2000 11:36:12 -0400
Content-Type: text/plain
----------
>From: "Pugh, Phil" <Phil.Pugh@COMPAQ.COM>
>
> We got caught out when we had a celidgh band. We did a peformance for a
> Masonic Lodge and at the end the MC asked us to 'play the Queen'.
No no. He just wanted you to camp it up a bit.
--
Nick Robertshaw
Grant me the serenity to accept the things I cannot change. The courage to
change the things I cannot accept, and the wisdom to hide the bodies of
those people I had to kill today because they pissed me off.
________
Subject: May Morning in Scotland
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Mon, 14 Feb 2000 13:49:19 -0400
Content-Type: text/plain
The engraving at
http://www.paraglyph.com/grafix/maydew.jpg
shows an alternative May morning tradition:
Dated May 1874, from The Graphic, it is entitled
"May-day morning in Scotland-Bathing in mountain dew"
It seems that the young lassies bathed (fully clothed) to the sound of a
concertina and were then dragged up a mountain. Aye, an' the laddies wore
trewsers, nae kilts.
Perhaps Norman should add that to his May-day goulash.
--
Nick Robertshaw
________
Subject: Re: Mummers and the Morris
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Sun, 9 Jan 2000 09:57:37 -0400
Content-Type: text/plain
Welcome to the MDDL.
How long have you been listening in on this prattle?
--
Nick Robertshaw
ParaGlyph. 301 694 8604
http://www.paraglyph.com
----------
>From: Georgina Boyes <georgina@NOMASTERS.FREESERVE.CO.UK>
>To: MORRIS@LISTSERV.IUPUI.EDU
>Subject: Re: Mummers and the Morris
>Date: Sat, Jan 8, 2000, 7:49 PM
>
> The complex of activities which might be described as "mummers plays" is so
> diverse and under-researched in terms of performers (and performance) that
> there's no basis for generalisations such as "Often, but not always, the
> mummers play was the property of an individual family..." We simply don't
> know. Research of the depth and quality provided by Keith Chandler on
> morris performers does not exist for traditional plays.
> Georgina Boyes
> -----Original Message-----
> From: Chris Bartram <chris_bartram@COMPUSERVE.COM>
> To: MORRIS@LISTSERV.IUPUI.EDU <MORRIS@LISTSERV.IUPUI.EDU>
> Date: 08 January 2000 19:08
> Subject: Mummers and the Morris
>
>
________
Subject: Re: Twelfth Day
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Thu, 6 Jan 2000 15:47:11 -0400
Content-Type: text/plain
Once the Magi arrive, the family grabs the Frankincense and Myrrh and uses
the gold to buy three tickets on a flight into Egypt. Put the crib on a
model 747 and hang it from the ceiling fan. Remember to send the Magi home
the other way around the table so they don't run into Herod again.
--
Nick Robertshaw
ParaGlyph. 301 694 8604
http://www.paraglyph.com
----------
>From: "Jenny Howard (Bedfordshire Lace)" <jehoward.samwhit@EXCITE.COM>
>To: MORRIS@LISTSERV.IUPUI.EDU
>Subject: Re: Twelfth Day
>Date: Thu, Jan 6, 2000, 8:57 AM
>
> On Thu, 6 Jan 2000 06:17:05 GMT, John Price <john.price@ZETNET.CO.UK> wrote:
>
>>Some of us notice and observe - at least in terms of making
>>sure the Christmas decorations are taken down! What awful fate would
>>befall us if we didn't, I wonder?
>
> While it is merely 'unlucky' in a general sense not to take them down on
> the 6th, (and I've never heard that it matters what time of day) if you are
> disorganised enough to leave them up till Candlemas,then you get hobgoblins
> moving in. That's what my Mum always said, anyway.
>
> The removal of decorations on the 6th always leaves you with a problem if
> your decorations include a crib. You've got the poor old Magi inching their
> way round the tabletop for the best part of a fortnight and as soon as they
> arrive at the manger, the whole thing is whisked away! We always used to
> leave the crib up till the following Sunday,(as indeed is liturgically
> correct) just to keep them happy.
>
> Jenny H
>
________
Subject: Re: Calling Bill Taylor
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Fri, 17 Dec 1999 08:33:59 -0400
Content-Type: text/plain
Or did he mean the one William Taylor that won't run away?
Alas, he was arrested and hanged for poaching.
--
Nick Robertshaw
ParaGlyph. 301 694 8604
http://www.paraglyph.com
----------
>From: KLOSKY@AOL.COM
>To: MORRIS@LISTSERV.IUPUI.EDU
>Subject: Re: Calling Bill Taylor
>Date: Thu, Dec 16, 1999, 7:03 PM
>
> Bill Brown graphically inquires:
>
> << Bill Taylor, calling Bill Taylor -- formerly of Foggy Bottom Morris Men,
> last known to be in the UK or Scotland. Anyone know how to reach him? >>
>
> Bill Taylor? Do you mean WILLIAM Taylor, the brisk young Sailor?
>
> I fear I saw a ball go through him...
>
> But you'll be comforted to know that he still had HIS half of your ring.
>
> With sympathy,
> Peter Klosky
>
________
Subject: Approaching Solstice lunacy
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Sun, 12 Dec 1999 09:58:30 -0400
Content-Type: text/plain
For those of you who celebrate celestial events, I pass on the following
notes on the approaching concurrence.
>>
>>This year will be the first full moon to occur on the winter solstice,
>>Dec. 22, commonly called the first day of winter. Since a full moon on
>>the winter solstice occured in conjunction with a lunar perigee (point
>>in the moon's orbit that is closest to Earth) The moon will appear
>>about 14% larger than it does at apogee (the point in it's elliptical
>>orbit that is farthest from the Earth) since the Earth is also several
>>million miles closer to the sun at this time of the year than in the
>>summer, sunlight striking the moon is about 7% stronger making it
>>brighter. Also, this will be the closest perigee of the Moon of the
>>year since the moon's orbit is constantly deforming. If the weather is
>>clear and there is a snow cover where you live, it is believed that even
>>car headlights will be superflous.
>>
>>On December 21st. 1866 the Lakota Sioux took advantage of this
>>combination of occurances and staged a devestating retaliatory ambush on
>>soldiers in the Wyoming Territory.
>>
>>In laymen's terms it will be a super bright full moon, much more
>>than the usual AND it hasn't happened this way for 133 years!
>>
>>Our ancestors 133 years ago saw this. Our descendents 100 or so years
>>from now will see this again.
>>
>>I'm excited, hope someone else might find this interesting! Remember
>>this will happen December 22, 1999.....
>>
>>
>>
>>
>>
>>
>>"We're fools whether we dance or not,
>> so we might as well dance."
>>
--
Nick Robertshaw
________
Subject: Re: General list abuse (was Should the Morris List dedum dedum...)
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Fri, 10 Dec 1999 07:40:35 -0400
Content-Type: text/plain
This could all be covered by a general 'No being an asshole' rule (Klosky
gets 2 free 'being an asshole' cards per year, of course).
Down with obsessive constitutionalism!! Burn the law books and the lawyers!
Just don't piss us off or we'll make you dance Longborough Trunkles in dry
sand.
--
Nick Robertshaw
----------
>From: Mark Rogers <mark@capers.co.uk>
>To: MORRIS@LISTSERV.IUPUI.EDU
>Subject: Re: Query - should the Morris list carry for sale items
>Date: Fri, Dec 10, 1999, 5:25 AM
>
> I agree with the following as well:
>
>> ( Not in any special order )
>> 1 ] The item(s) are for personal sale / wanted only.
>> 2 ] No dealers or shops allowed.
>> 3 ] No profiteering
>> 4 ] Items are, or are likely to be used in forms of Morris
>> performance.
>
> although 4] could be altered to "morris related items" to include archive
> material & books about morris. The black book for instance is not used in
> a performance (apart from by a few musos who have to have the dots in
> front of them!), but is definately morris related.
>
> Definately agree with 1 & 2. I can imagine when 3] might night be stricly
> applicable - say someone came up with a morris calendar and made a smallm
> profit.
>
> On the whole, I'd say stick to the above, but be gently flexible when the
> need arises.
>
> Mark Rogers
> http://www.capers.co.uk/donkey/
________
Subject: Re: reading and playing music (was, keys....)
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Thu, 9 Dec 1999 15:28:42 -0400
Content-Type: text/plain
Er,
I was referring to the Roland TB-303 transistor bassline. The foundation for
various acid techno music genres. But I 'spect you knew that.
--
Nick Robertshaw
ParaGlyph. 301 694 8604
http://www.paraglyph.com
----------
>From: Ken Hamilton <K.C.Hamilton1@Bradford.ac.uk>
>To: MORRIS@LISTSERV.IUPUI.EDU
>Subject: Re: reading and playing music (was, keys....)
>Date: Thu, Dec 9, 1999, 4:34 PM
>
> On Thu, 9 Dec 1999 10:07:12 EST KLOSKY@AOL.COM wrote:
>
>> Which model SMLE? The flash-guard on the Mark V Jungle Carbine would
> seem to
>> lend the best mouthpiece...
>
> I think you are all very sad.
>
> Ken "Never does anything without a deep and meaningful
> spiritual reason" Hamilton
>
> ----------------------
> Ken Hamilton
> http://www.geocities.com/Nashville/Rodeo/2122/
>
________
Subject: Re: reading and playing music (was, keys....)
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Thu, 9 Dec 1999 07:26:23 -0400
Content-Type: text/plain
A morris tune for the 303 (now there's an instrument Greg could start
with)?? Where can this be found, I gotta have it?
Nick
Out morrisman, closet raver.
>
> I'd hazard that this has a bearing on some of the "border" morris stuff,
> where musicianship varied greatly. There were the William Preeces and
> John Lockes, who obviously played well, and made money playing for other
> things than morris, and at the other end of the spectrum there were the
> un-named muso's who drew the short straw and had to turn in a passable
> tune on whatever instrument they could lay hands on (mouth-organ and
> bones) for boxing day, because the other four guys only jigged around
> anyway and it wasn't much of a show without music. I keep thinking of
> resurrecting the Kingston tune, but it has more in common with acid
> trance than with what most people would recognise as folk melody. Poor
> b*gger, I'll bet he was freezing cold as well...
>
> regards
> Andy A
________
Subject: Re: Keys, modes, and boomps-a-daisy (Long, nmc, but a lot of music content)
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 8 Dec 1999 08:11:36 -0400
Content-Type: text/plain
Richard's explanation most excellently proves the problem with equal temper.
Note that since this is a defect in the factoring, it has a greater effect
at higher frequencies (faster, off-tune beating) than at lower frequencies.
This is a problem that is about as tractable under the pressure of a fresh
approach as the calendar (why not just have 16 months of a 32, 16-hour days,
adjusting the length of an hour to 64 'New Minutes'?). Go ahead, Greg,
you'll make it work and life will be so much easier for computers.
For a good update on human perception of musical pitch, temper, rhythm and
harmony (and a ripping good read), I recommend:
Music, The Brain, and Ecstacy, (sounds like it should have received rave
reviews) by Robert Jourdain
http://www.amazon.com/exec/obidos/ASIN/038078209X/002-7451840-0885024
--
Nick Robertshaw
ParaGlyph. 301 694 8604
http://www.paraglyph.com
>
> The problem that equal tempering addresses is how to tune an instrument so
that
> it is equally in tune (or out of tune) in all keys.
> This is done by a mathematical trick. We've decided that we'll divide an
octave
> into twelve equal semitones. As octaves and scales work by multiplying the
> fundamental by some amount, we need one factor to multiply by. When we
multiply
> the fundamental frequency by it twelve times, it needs to give us a new
frequency
> twice the fundamental.
>
> This factor is the twelfth root of 2. If we call it X, then :
>
> f * X * X * X * X * X * X * X * X * X * X * X * X = 2f
>
> or
>
> f * (X^12) = 2f
>
> (X = 2^(1/12) = 1.059463, according to this PC)
>
> If you do the maths for an equal tempered fifth, it is not 3f/2, which a
proper
> fifth should be. It's 1.4983 (X^7), rather than 1.5. This is the by now
probably
> famous 'out of tune equal tempered fifth'.
>
>
> I don't know the rules for other temperaments, or why the notes are called
what
> they are. I'd need to sit down with a computer/calculator for a while to check
the
> other intervals in a normal major scale.
> The JavaTuner page (http://www.globetrotter.net/gt/usagers/roule/accord.htm)
> has some links to documents about other temperments.
>
>
>
> Helpfully (and hopefully not too confusingly),
> Richard.
>
________
Subject: Re: Early Music (NMC - really, really, NMC)
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Mon, 29 Nov 1999 16:25:18 -0400
Content-Type: text/plain
This was a careless anachronism. All BC boxes are 2-row.
--
Nick Robertshaw
ParaGlyph. 301 694 8604
http://www.paraglyph.com
> Can any of the melodeon experts out there hazard a guess as
> to what tuning a single-row melodeon, with black ends and
> red bellows, would have been in around 600 BC?
>
> I only ask because there was a guy playing one in a band on
> "Xena - Warrior Princess" the other night...
>
> Sandy
>
> http://welcome.to/captainwebb
>
________
Subject: Re: Keys for morris tunes (NMC)
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Tue, 23 Nov 1999 19:11:15 -0400
Content-Type: text/plain
I remember learning this in music theory. Re-reading it 30 years later I
notice that if one substitutes signs of the Zodiac for the keys, it works
just as well:
Capricorn: You are expressive of feeling in a pure, certain, and decisive
manner, of innocence, powerful resolve, and manly earnestness; and open to
deep religious feelings. Try playing Princess Royal in A major today.
See.
--
Nick Robertshaw, justly tempered
----------
>From: Jeff Bigler <jcb@MIT.EDU>
>To: MORRIS@LISTSERV.IUPUI.EDU
>Subject: Re: Keys for morris tunes (NMC)
>Date: Tue, Nov 23, 1999, 7:38 PM
>
> John Carver writes:
>
>> Changing the key does change the quality of the tune in a subtle way.
>> (and therefore the quality of the MORRIS DANCE). The difference you
>> sense is not the pitch but the note intervals. It's an effect of equal
>> temperament, an eighteenth century invention for munging all the keys
>> together onto one instrument without wasting string.
>
> Hermann Helmholtz wrote some interesting descriptions of what the
> various keys "sound like" in his book, "On the Sensations of Tone" in
> 1885. His descriptions of G major and D major are kind of
> interesting/appropriate when applied to morris dancing. The following
> is from Alexander J. Ellis's translation of that work.
>
> Presumed Characteristics of Major and Minor Keys
>
> C Major - Expressive of feeling in a pure, certain, and decisive manner, of
> innocence, powerful resolve, manly earnestness, deep religious feeling.
> C Minor - Expressive of softness, longing, sadness, earnestness and
> passionate intensity, and of the supernatural.
> C# Major - Scarcely used; as Db it has fulness [sic] of tone, sonorousness,
> and euphony.
> Db Minor - The most intensely melancholy key.
> D Major - Expressive of majesty, grandeur, pomp, triumph, festivity,
> stateliness.
> D Minor - Expressive of subdued melancholy, grief, anxiety, and solemnity.
> Eb Major - Greatest variety of expression; eminently masculine, serious and
> solemn; expressive of courage and determination, brilliant, firm,
> dignified.
> Eb Minor - Darkest and most sombre key of all; rarely used.
> E Major - Expressive of joy, magnificence, splendour, and highest brilliancy;
> brightest and most powerful key.
> E Minor - Expressive of grief, mournfulness, and restlessness of spirit.
> F Major - Expressive of peace and joy, also of light passing regret and
> religious sentiment.
> F Minor - Harrowing, full of melancholy, at times rising into passion.
> F# Major - Brilliant and very clear; as Gb expresses softness and richness.
> F# Minor - Dark, mysterious, spectral, and full of passion.
> G Major - Favourite key of youth; expresses sincerity of faith, quiet love,
> calm meditation, simple grace, pastoral life, and a certain humour and
> brightness.
> G Minor - Expresses sometimes sadness, at others quiet and sedate joy, with
> gentle grace or a slight touch of dreamy melancholy, occasionally rising
> to a romantic elevation.
> Ab Major - Full of feeling and dreamy expression.
> Ab Minor - Fit for funeral marches; full of sad, heartrending expression, as
> of an oppressed and sorrowing heart.
> A Major - Full of confidence and hope, radiant with love, redolent of genuine
> cheerfulness; especially expresses sincerity.
> A Minor - Expresses tender womanly feeling, especially the quiet melancholy
> sentiment of Northern nations; also fit for Boleros and Mauresque
> serenades; and finally for sentiments of devotion mingled with pious
> resignation.
> Bb Major - Has an open, frank, clear, and bright character, admitting of the
> expression of quiet contemplation; favourite classical key.
> Bb Minor - Full of gloomy and sombre feeling, like Eb; seldom used.
> B Major - Expresses boldness and pride in fortissimo, purity and perfect
> clearness in pianissimo; seldom used.
> B Minor - Very melancholy; tells of quiet expectation and patient hope.
>
>
> Jeff Bigler
>
________
Subject: Re: Stop the flaming now! (was Re: Stop this two-list madness now!)
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Thu, 18 Nov 1999 12:14:51 -0400
Content-Type: text/plain
Well, if we subscribe each list to the other, we can have a nice mail loop
with lots of posts about the problem with the mail loop and lots of other
posts that say stop posting we're trying to fix the mail loop.
Or we could move to usenet by creating rec.dancing.morris and have people
issuing court injuctions at one another (cf. rec.downhill.skiing).
Or we can have the Popular Front of Judea list and the Judean Popular Front
(phlbtt!) list and the People's Judean Front list...
Or we could just stay here and remember our manners. Which is pretty much
what happens anyway.
So who want's to join me in an Anti-schism splinter group?
--
Nick Robertshaw
Having a smoking area in a restaurant is like having a
pissing area in a swimming pool.
________
Subject: Re: Effeminancy perceptions (LMC)
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Tue, 9 Nov 1999 08:25:20 -0400
Content-Type: text/plain
----------
Said The Esteemed Peter Klosky, KLOSKY@AOL.COM
> Add a pervasive dose of Hollywood "macho" -- Valentino, Gable, Bogart, Cooper
> & Wayne (can you imagine those guys doing "Dearest Dickie?"-- though I'd've
> loved to see Cagney dance rapper!)... voila, a mid-twentieth century male
> mythos.
>
Your theory may be in trouble Peter:
Valentino played Nijinsky didn't he?
And what about Astaire? Kelly? Crosby? Travolta? Swayze? etc..
Hollywood has it's share of dancing babe-magnets, some of whom do action
roles also.
--
Have you ever imagined a world with no hypothetical situations?
Nick Robertshaw
________
Subject: Re: Effeminacy (was:Records? (no longer new, just very long)
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Mon, 8 Nov 1999 17:14:13 -0400
Content-Type: text/plain
>
> What my generation of American men has lost, I think, is the sense that
> dance is important, that men are expected to dance, that it is a basic part
> of how we live and express ourselves. And that, as it is so important, it
> has to be perfected and worked at. Now it seems that dance is just plain
> suspicious. In truth, it's manly, Goddammit!
>
Word.
(as they say in the rave culture, where it's ok for guys to dance too)
--
Nick Robertshaw
Morrisman raver and father of morrisman raver
________
Subject: The History of Morris Dancing (1548-1750)
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Sun, 7 Nov 1999 08:58:33 -0400
Content-Type: text/plain
Hey guys, if you want to be able to quote your own 'gaily dancing' or 'vile
devilish perversion' morris reference, you will be pleased to hear that the
long-awaited work of Mr John Forrest <jforrest@zeppo.hm.uc.edu> "The History
of Morris Dancing (1548-1750)" is now on the press.
All inquiries should, of course, go to John.
>
--
Nick Robertshaw
----------
From: John Forrest <jforrest@zeppo.hm.uc.edu>
>
> Now for some good news. I just received advanced copies of my book THE
> HISTORY OF MORRIS DANCING today from the English publisher. The Canadian
> publisher says they will have bound books very soon. So I thought now
> might be a good time to put out a typically vainglorious self advertisement
> on MDDL. I used to ask Steve Corrsin to do this kind of thing for me, but
> he finally got tired of the list and quit. So I was wondering if you would
> be willing to post something (short) for me? In fact I could even write it
> now! Thanks.
>
> ______________
>
> Morris dancers will be pleased to know that I have just received an
> advanced copy of my latest work THE HISTORY OF MORRIS DANCING (1458-1750)
> from the English publisher, James Clark. The North American publisher,
> University of Toronto Press promises copies very soon. All morris dancers
> should find the book worthwhile reading. It is a fat book (439 pages)
> stuffed with all kinds of detail that should keep you reading, talking, and
> arguing for years. But remember, this kind of research will only continue
> if people buy the books that it is published in; so I invite you to do your
> bit as a supporter of original research and place an order today.
>
>
> John Forrest
________
Subject: Men-only fertility dance
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 27 Oct 1999 12:14:19 -0400
Content-Type: text/plain
Oops.
Sorry. Just thought it was a bit quiet.
--
Nick Robertshaw
________
Subject: Re: Boiled nuns (nmc)
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 20 Oct 1999 08:27:55 -0400
Content-Type: text/plain
Actually, consumption of nuns on a Friday is acceptable if you can come up
with a convincing proof that a nun is actually a fish. Let me see...
Natural history of the nun.
Nuns lay eggs (parthenogenically) which hatch into penguins. The penguins
grow and become orca, obviously a fish--don't believe any whales-are-mammals
apostasy, see the Jonah story. The orca gets cast up on the rocks and bursts
open, releasing dozens of nuns of the Cetacean order. From this we see that
a nun is a fish and can therefore be consumed on a Friday.
Bizarre though it might seem, there is a parallel in history. The goose
barnacle was claimed to metamorphose into the barnacle goose for similar
culinary reasons.
--
Nick Robertshaw
>
>>Nunnite? Probably pretty good for a meatless Friday. (If you got a young
>>one...)
> Tut, tut, Peter, you've clearly been away too long. Nuns are after all
> creatures of flesh and all meat products whether solid or liquid count as
> meat for the purposes of days of abstinence.
>
> I wonder,is the fact that nuns nowadays rarely wear identifying dress an
> example of natural selection at work?
>
> Jenny H
>
________
Subject: Pork!
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Tue, 12 Oct 1999 08:43:13 -0400
Content-Type: text/plain
(What is the capital of Hungary?)
><< Are there any rousing chorus songs about pork feasts? >>
How about the song that has three unspellable words:
There was an old farmer who had an old sow
<unspellable word 1> ow,
<unspellable word 2> ow,
<unspellable word 3> idle-dee-dow,
Suzannah's a funnicle man
<unspellable word 1> an,
<unspellable word 2> an,
<unspellable word 3> idle-dee-dan,
Suzannah's a funnicle man
etc..
A great song for clearing the sinuses and raising the humidity.
--
Nick Robertshaw
________
Subject: Archers Dance
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 6 Oct 1999 08:19:40 -0400
Content-Type: text/plain
>>
>> A couple of us wanted to do something to the Archers theme, but were
>> told by one of our musicians that it doesn't have a B part, though I'm
>> sure one could be worked out if necessary.
>
> The theme isn't organised in A's and B's as such but there is music that
> could be used as a B part. I suggest you get your musician to actually
> listen to the piece sometime.
>
It can and has been done. The dance was Dan and Doris in the style of
Ascot-under-Wychwood. Herga Morris, circa 1972. It never really 'stuck'.
Nick Robertshaw
"For lo, the coming of the internet shall spur the
flagrant and promiscuous misuse, misappropriation,
and unrighteous attribution of quotations both famous
and obscure."
-- Ezekiel 12, v 7
________
Subject: Audience appeal of massed dances
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Fri, 1 Oct 1999 10:15:57 -0400
Content-Type: text/plain
Perhaps the audiences like the massed dances because they can SEE better
once all the people in funny clothes are dancing, not standing in the bloody
way.
As a follow on to Peter Klosky's observation of the loyalty of the Falls
River public at the Xdz, it is interesting to note that the Newfane audience
at the Marlboro Ale is similarly patient and appreciative. These are places
and occasions that have locked morris into the local culture and calendar
and given it special relevance.
I guess 20 years buys you a tradition.
--
Nick Robertshaw
________
Subject: Re: The Ring (finally?, yeah, right!)
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Thu, 30 Sep 1999 08:08:48 -0400
Content-Type: text/plain
As a practical matter, getting expelled from the Ring is extraordinarily
difficult. The Smiffs tried for years and eventually gave up and simply
resigned.
--
Nick Robertshaw
ParaGlyph. 301 694 8604
http://www.paraglyph.com
>
> I believe (though I'm on thin ice here, as I'm no expert) that there
> are only two "sanctions" available.
>
> 1. The Squire of The Ring could give someone a firm talking to. This
> often has a sobering effect at a Ring Meeting, where The Squire
> obviously has an overall responsibility for the conduct of the event
> and can therefore "lay down the law". Outside of a Ring Meeting, I
> think he could/would take action only if behaviour were severely
> deleterious to The Ring - not simply bad PR for the rest of us.
>
> 2. The offending club could be suspended or expelled, after due
> process. This seems to be very much a last resort, and rightly so. I
> don't know when it last happened, but I'd be willing to bet that it's
> not recently.
>
> Neither of these seems appropriate to the situation Keith refers to,
> so The Ring is stuck with being tarred by a brush that it does not control.
>
________
ubject: Re: Immitation "clay pipes"
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Fri, 24 Sep 1999 08:38:02 -0400
Content-Type: text/plain
Straws filled with mercury fulminate can be used to speed the training
process for beginners.
--
Nick Robertshaw
________
Subject: Re: workers' struggle
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 22 Sep 1999 08:16:28 -0400
Content-Type: text/plain
Well, that's at least two persons' belief systems in obvious need of
adaptation.
Or perhaps just two examples of the mystery of the morris.
--
Nick Robertshaw
ParaGlyph. 301 694 8604
http://www.paraglyph.com
"The advent of email has spurned the
flagrant and promiscuous misuse, misappropriation,
and mis-attribution of quotations both infamous
and obscure."
--Sophie Tucker
----------
>
> Norman Stanfield wrote:
>
>> The mystery to me is how anybody could dance morris without
>> knowing this
>> stuff.
>
> Why???
>
> The mystery to me is how anybody could think that this stuff has any
> relation to morris.
>
>
> Derek Matthews
> Leeds MM
>
________
Subject: Re: simple and difficult pipe and tabor
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Mon, 20 Sep 1999 11:16:01 -0400
Content-Type: text/plain
As noted previously on this list, if you do get a hemiola, it's essential to
get a cold compress on it as soon as possible. Keep the weight off and
elevate the affected part BEFORE you have that 'nice cup of tea'.
--
Nick Robertshaw
ParaGlyph. 301 694 8604
http://www.paraglyph.com
>
> I frequently play a hemiola on the tabor in 6/8 tunes to show the exact
> placement of the hop-hop in galleys, which works quite well. If you're
> having trouble placing these exactly, some of the musicians I know use
> the phrase "nice cup of tea" to denote the placement of each note of a
> 3-against-2 hemiola. (And for those of you who like such things, "pass
> the melted butter" works for 5-against-4.)
>
> Jeff Bigler
>
________
Subject: Re: Flying Accordions
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Mon, 13 Sep 1999 10:15:57 -0400
Content-Type: text/plain
Previous discussions on the squeezebox list seemed to conclude that the bass
end of a peyanna o'corjun was the most vulnerable part during air transit
and would often fall victim to the 'all buttons down' syndrome.
One frequent flyer with PA reported that he removes the bass end and takes
it on as carry-on, presumably cradling it to his bosom during turbulence. I
believe he fills the void left in the PA case with a suitably sculpted piece
of foam plastic.
--
Nick Robertshaw
________
Subject: Re: Tradition (Nearly Morris Content)
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Fri, 10 Sep 1999 15:37:53 -0400
Content-Type: text/plain
The problem with dancing morris because it's 'traditional' may be that the
reason is itself not traditional. Were the Old Dead Guys so unlike us in
their motivations? Is there no chance that they did it for FUN too? If so,
that would make the recreationalists more traditional than the
traditionalists.
--
Nick Robertshaw
ParaGlyph. 301 694 8604
http://www.paraglyph.com
----------
>From: Norman Stanfield <nlstanfield@HOME.COM>
>To: MORRIS@LISTSERV.IUPUI.EDU
>Subject: Re: Tradition (Nearly Morris Content)
>Date: Fri, Sep 10, 1999, 2:37 PM
>
> At 11:26 PM 09/09/99 -0700, Mr. Thayer gave us a timely quote:
>
>>"Ah tradition -- the true driving force of history! It makes royalty out
>>of rogues, elevates gibberish into cherished ritual. Tradition has the
>>depth of an eggshell -- while appearing as impenetrable and
>>unquestionable as the polar ice cap."
>
> I can add another word to this fire: "heritage". I have just finished
> browsing through Scotland the Brand: the Heritage Industry, by Richard Kiely
> et al., and he thoroughly roasts that shibboleth as well. They wrote their
> book as a follow-up to Patrick Wright (On Living in an Old Country: the
> national past in contemporary Britain) and Robert Hewison (The Heritage
> Industry: Britain in a climate of decline), using Scotland as their
> "sample". (And who can forget that heart-warming fireside story, The
> Imagined Village: Culture, Ideology, and the English Folk Revival, by
> Georgina Boyes?)
>
> We could be at the threshold of a new term, "fakelore", in keeping with Dave
> Harker's inflammatory term, "fakesong".
>
> In the eyes of these authors, we're all a lot of Wallies. Some more than
> others. Groups like 7 Champs and Flag and Bones are exempt, I suppose,
> because they've taken morris to the next level.
>
> We need a champion, but there appears to be none on the horizon. Our
> resident academics, like Mike Heaney, seem to struggle with morris as it
> exists today.
>
> No doubt the trend to take "England" out of morris, releasing it to the
> world of universal recreation, could be the salvation of the activity.
>
>
> Norman Stanfield
> Vancouver, B.C., Canada
>
________
Subject: Re: Prince Albert's
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Fri, 27 Aug 1999 16:03:26 -0400
Content-Type: text/plain
Wow, you mean...
I've dance with a team
Who've danced with a team
Who've danced with the Prince of Wales?
--
Nick Robertshaw
----------
>From: Ian & Hilda Dedic <dedics@DIRCON.CO.UK>
>To: MORRIS@LISTSERV.IUPUI.EDU
>Subject: Prince Albert's
>Date: Fri, Aug 27, 1999, 3:10 PM
>
> Smiffs danced with Prince Albert in Covent Garden a few weeks ago, and
> a good time was had by all -- and they do know several dances now.
> One reason the tour worked is probably the extreme contrast between
> Smiffs and Alberts which meant the audience didn't lose interest -- we did
> our thing, they did theirs, and both were well received.
_________
Subject: Re: sticks
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Tue, 27 Jul 1999 10:02:14 -0400
Content-Type: text/plain
>From: keith Leech <keith_leech@CSI.COM>
> *Aim for the sky not his
> head!* So in summary, I think it depends on the tradition.
It might also depend on the partner.
________
Subject: Re: Morris Resources (but VLMC)
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Fri, 16 Jul 1999 13:25:27 -0400
Content-Type: text/plain
Howard:
1: On my version of Outlook Express, there is a Tools menu that lets you set
up a variety of sigs.
2: It's easy to forget the the shiny-car people now work for
Ford/Jaguar/BMW/RJ Reynolds/Grand Met/Virgin.
3: True. You're not a whore if you're giving it away.
4: The watch-reader analogy is good. I shall steal it.
5. The Bailey Bridge transporter offer is accepted! We will be touring the
UK next year and it will make our routing easier and avoid toll fees. I'll
bet we can cause a bunch of misrule and downtrodden worker solidarity with
it too. Rather than putting little flags on the 'wings', we'll just paint in
the team colors.
p.s. Does it come with a full tank of fuel?
--
Nick Robertshaw
FBMM 4mn
----------
>From: "Mitchell, Howard G" <howard.mitchell@EDS.COM>
>To: MORRIS@LISTSERV.IUPUI.EDU
>Subject: Re: Morris Resources (but VLMC)
>Date: Fri, Jul 16, 1999, 12:38 PM
>
>> Bill Brown wrote:
>>
>>I can't help noticing the diverse and interesting careers of
>>morris-dancers, as indicated by the "sigs" on their e-mail messages to the
>>MDDL.
>
> Dear support desk,
> can you advise me on how to configure MS Exchange so that mail going to
> private addresses does not contain my corporate signature. No this doesn't
> mean all internet addresses! Just the ones where some wise guy will think
> that they can get EDS to stump up some community investment or even
> thinks that Rolls-Royce makes cars/automobiles.
>
>>Sometimes these vocations can be valuable resources to the morris
>>community, especially when services and talents are contributed free,
>>gratis, pro-bono and for no charge.
>
> I'm having difficulty with the association of the words "free" and
> "consultant".
>
>>Reading today's MDDL, I was particularly struck by Mr. Mitchell's business
>>association,
>
>> >Howard Mitchell
>> >Manchester Morris Men
>> >Howard Mitchell
>> >Strategy Consultant
>> >EDS - Rolls Royce
>>
>>and a particularly brilliant (if I may say so) Idea came to mind. It would
>>generate all sort of wonderful benefits to the Rolls Royce company (too
>>numerous to mention here, but I'm sure a Strategic Consultant worth his
>>salt could list them with no trouble)
>
> I only borrow other peoples watches and tell them the time. If they pay
> enough, I might teach them how to tell the time for themselves.
>
>>to make available a small number of
>>vehicles (a dozen or two) to American morris teams visiting England. The
>>minor wear and tear on these vehicles could no doubt be written off, or
>>chalked up to improving international relations and tourism and stuff.
>
> I'm looking at the product list for Roll-Royce plc for types of vehicles
> which
> might be suitable. How do you fancy a military bailey-bridge transporter?
> I can do a 50 Mega-Watt gas turbine but it doesn't come with any wheels.
> No cars.
>
>>PS. We'd like the ones with the little flag-holders on the fenders, please.
>
> But if you put flags on the fender, the fire will melt them.
> (UK-US translation required here).
>
>
> Regards
> Howard Mitchell
> Manchester Morris Men (but not for much longer)
>
> Corporate sig omitted.
>
________
Subject: Re: Maps & Jemmers
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Tue, 29 Jun 1999 12:08:50 -0400
Content-Type: text/plain
Jemmers were factory girls. The name derives from the typical contents of
their lunch box: a jam sandwich, as distinct from a typical male worker's
sandwich, which would at least contain a heel of cheese or a slice of black
pudding.
Well, that's how they explained it to me back in the 70s, when they were
very 'interactive'.
Perhaps the dress put them off, Bruce.
--
Nick Robertshaw
ParaGlyph. 301 694 8604
http://www.paraglyph.com
----------
>From: "Bruce Henderson (Bluemont)" <bhenders@LANDROVER.COM>
>To: MORRIS@LISTSERV.IUPUI.EDU
>Subject: Maps & Jemmers
>Date: Tue, Jun 29, 1999, 10:58 AM
>
> OK, can your computer tell me what a "Jemmer" is? I have spent the
> past Saturday with the "Poynton Jemmers" -- I got it figgered out that the
> Poynton Jemmers are Jemmers from Poynton, but couldn't get too much farther
> than that. Anybody help?
> Thanks, Bruce Henderson (BlueMont, VA; Sherborne, Glos.; occasional
> band member Wicked Stix, et al.)
> (Sorry I couldn't ask any of them but they seem about as willing to
> interact with other teams as Rock Creek.)
>
________
Subject: Hammersmith vs Chingford
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Tue, 29 Jun 1999 10:20:12 -0400
Content-Type: text/plain
OK chaps, if we must evaluate all teams according to this linear perspective
let's do it properly. We'd need an 'Academy Award' viewpoint where only
foremen of Ring sides voted, plus a 'People's Choice' viewpoint where anyone
can vote. Maybe a league competition and a knockout competition. A Best of
Breed, Best of Class, Best in Show award. We would once and for all know who
has the best kit, the best music (solo and band), the most traditional
presentation, best announcer, best beast, best original dance, best fool,
best drinkers, best singers, best at staying up late and waking the most
people, and best ad hominem argument on the MDDL.
Clearly, getting all the teams in order of merit will take some time, but we
can start right away with Chingsmith and Hammerford, who should immediately
put an .avi RealVideo or Quicktime (whichever's best) of their best dance on
their best day on their web sites so that the MDDL members can advise them
on how to improve on all the areas that prevent them from being better than
each other.
--
Nick Robertshaw
________
Subject: Re: How to make Cotswold sexy?
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 23 Jun 1999 09:27:46 -0400
Content-Type: text/plain
> I was once told that the sax wasn't 'traditional', as it was
> invented by a German in the 19th century.
Nope. It was invented by one of the Hundred Famous Belgians.
Paul Draper suggested:
>Even on pub tours you can put on a program that builds excitement. Get
>off to a good start with a processional dance on or something like
>Saturday Night, follow up with a long stick dance or fighting dance, a
>short sharp dance and then a jig from someone, something a bit more
>gentle/flowing/relaxed and then raise the excitement with another stick
>dance before a Bonny Green off or Hey Diddle Dis.
Which seems to imply that >long< corner dances and simple sidestep-half hey
chorus dances have no place in Sexy Cotswold. That is assuming that the
'gentle/flowing/relaxed' bit was watching the barmaid pull a pint of bitter.
Humor aside, Paul makes a good point. Anyone who program(me)s Jockey
following Trunkles is inviting audience disregard.
--
Nick Robertshaw
_________
Subject: Re: That Hudson/Tingey list continued.
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Tue, 22 Jun 1999 09:25:06 -0400
Content-Type: text/plain
>> 14 The English countryside
>> 15 Stilton with Christmas cake
>>
>>
> 16. Sloe Gin
> 17. Punch and Judy
> 18. Stilton with Port
> 19. Church towers and steeples
> 20. Old castles.............
21. Marmite
22. Village green cricket
23. Public footpaths
24. Blackbird song after rain
25. Pealed bells
26. Pie and mushy peas
27. Chocolate Digestives
28. Salad cream
29. Boy choir voice production
30. Radio 4
31. Panto!
32. Wearing vests and knickers on the inside
________
Subject: Fore Kalia
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 12 May 1999 18:26:57 -0400
Content-Type: text/plain
While others find they've fought to forgo the forgoing forms of foreman. I
find myself for the four who favo(u)r the forementioned former form of
foreman.
The team, however, has been known to use alternative titles:
Sarcastic English Twit
Nitpicking Slave Driver
Danceus Interruptus
He-who-can-be-ignored
Flip-flopping Arbitrarian
Hide-bound Traditionalist
Iconoclastic Anti-traditionalist
Kalia should note that she may not assume these titles and neither will they
be carelessly thrust upon her; they must be *earned*. In her position, I'd
probably strive for "Alpha-Bitch" but that might not suit all personalities.
Consider some other alternatives:
Stepmistress (might work for White Rats)
Leap-leader
Ped-aunt
Visionary Genius
Direktor of Central Planning and Rectitude
Standards Officer
Capering Manager (or Managing Caperer)
Overseer in charge of oversights
'Foreman' begins to sound a lot more attractive, doesn't it? No? Then how
about 'The High Kalia'
--
Nick Robertshaw
Foreman, Autistic Director: Foggy Bottom Morris Men
May the Fores be with you
p.s. Kuh-`Lee-uh? Kay-`Lye-uh? `Kay-Lia? `Kah-Lia? How do you pronounce it?
________
Subject: Doing May Morning Right
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Thu, 6 May 1999 17:34:16 -0400
Content-Type: text/plain
For a traditional May celebration, I offer this account by Philip Stubbes
(1583), as quoted in Frazer:
"Against May, Whitsonday, or other time, all the yung men and maides, olde
men and wives, run gadding over night to the woods, groves, hils and
mountains, where they spend all night in plesant pastimes; and in the
morning they return, bringing with them birch and branches of trees, to deck
their assemblies withall. And no mervaile, [sic] for there is a great Lord
present among them, as superintendant and Lord over their pastimes and
sports, namely, Sathan, prince of hel. But the chiefest jewel they bring
home from hence is their May-pole, which they bring home with great
veneration, as thus.
They have twenty or fortie yoke of oxen, every oxe having a sweet nosegay of
flouers placed on the tip of his horns, and these oxen drawe home this may
pole (this stinkyng idol, rather), which is covered over with floures and
hearbes, bound about with strings, from the top to the bottom, and sometimes
painted with variable colors, with two or three hundred men, women, and
children following it with great devotion. And thus being reared up, with
handkercheefs and flags hovering on the top, they straw the ground around
it, binde green boughes about it, set up summer haules, bowers, and arbors
hard by it.
And then they fall to dance about it, like as the heathen people did at the
dedication of the Idols, whereof this is a perfect pattern, or rather the
thing itself. I have heard it credibly reported (and that viva voce) by men
of greate gravitie and reputation, that of fortie, threescore, or a hundred
maides going to the wood over night, that scaresly the third part of them
returned home again undefiled.'
Philip could be a real prick sometimes.
--
Nick Robertshaw
Having a smoking area in a restaurant is like having a
pissing area in a swimming pool.
________
Subject: Re: May Morning
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Thu, 6 May 1999 17:06:59 -0400
Content-Type: text/plain
Curious thing this.
When I returned to my London side, Herga Morris, after a 3-year stint in
Scotland, I suggested (this would be '75 or '76) that we should dance the
sun up on May Day (in a field on Stanmore Common, as it happened). Without
demanding justification from tradition or verifiable historical sources, the
team agreed that this was a splendid idea and this we then did. The
'tradition' was then repeated in subsequent years, AFAIK until the Herga
Morris diaspora of the early 80s.
I honestly don't believe that I got the idea from anywhere, although it
might have come via John Forest (an Ancient Man and therefore probably a
former Oxford May morning dancer) who would hang out with Herga from time to
time. It clearly seemed 'resonant' enough to the side to be worth staggering
out of bed and getting our socks wet for.
So what do we know? There are widespread traditions of Maying that involve
pre-dawn activities--gathering the May, testing the solubility of milkmaids
in dew, wetting the 'osses 'ead. The Merrie Englanders had no trouble
dragging the morris into Maying (along with the ME peripherals from the
Robin Hood legends). From the Urals to the West of Ireland, the Spring
celebrations cover St George's Day, May Day, and Whitsuntide with various
melds of Green Men, May Kings and Queens, Floral festivals, and festive
display dances. This mixture seems to indicate that the cultures borrowed
from one another (or shared common roots) in finding ways to celebrate what
is a jolly-nice-time-of-year.
In other words, it was traditional even before it was first done.
--
Nick Robertshaw
4mn, FBMM. Ex smiff (no dawn dances), Herga, Brackley (no dawn dances)
http://www.paraglyph.com
----------
Norman Stanfield (welcome back, Norman) asked:
>
> Are there any records or memories of English Morris sides "dancing up the
> May 1st dawn" before 1975, *other* than the historical occasion of the OUM
> in 1923? 1975 was apparently the year that Roger Cartwright founded May
> Morning Morris (with no expectations of an audience) in America.
>
> I assume that the OUM continued the tradition after 1923 at Magdelene
> College. But did other teams decide to "do dawn" as they were doing, but
> *without* any audience (unlike Oxford)?
>
> cheers
>
> Norman Stanfield
> Vancouver, B.C., Canada
>
________
Subject: Re: Pinhead - beer volumes (NMC)
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 21 Apr 1999 08:52:14 -0400
Content-Type: text/plain
Another example of the knickers-and-vests type of Anglo-American divergence.
The English say:
> "A Pint of pure water weighs a
> pound-and-a-quarter
The Americans say:
A pint is a pound the world over.
Also an example of the ignorant insularity that lets them conduct a baseball
'World Series' to which they invite only themselves (and the Canadians, whom
they regard as American anyway).
--
Nick Robertshaw
As the hectic pace of life rushes you along,
try to set aside a few minutes each day.
At the end of the year,
you'll have a couple of days saved up!
________
Subject: Re: folk music only on the left?
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 17 Mar 1999 09:44:19 -0400
Content-Type: text/plain
The Nazis had no difficulty in applying Volksliede to the purposes of the
right. Composers and collectors (C# included) recognized that folksong was
an expression of nationalism. Banks of the Sweet Primeroses was actually
Bugger Off you Sodding Furriners.
Fortunately for us, the term Folk Music is now taken to mean 'anything that
is sung exactly as written in Rise Up Singing.'
--
Nick Robertshaw
Why are there braille signs on drive-up ATMs?
Why are there Interstate Highways in Hawaii?
Shouldn't 'phonetic' be spelled 'Fennettick'?
> In the present discussion of what is "folk music" there seems to be an
> underlying assumption that to be valid, it must be on the political left;
> and I guess that also means that true "folk" must be leftwise likewise.
> And perhaps also unreligious?
>
> I would dispute that underlying assumption. I'd argue that, for example, a
> great deal of religious music is, by any definition tortured or otherwise,
> folk music. And while the right, at least in the States, hasn't produced
> an equivalent to Woody Guthrie, I'm sure it wouldn't be hard to find
> racist music (for example) that would fit the same definitions.
>
> English folk music from a non-lefty perspective... Oh, I don't know, I'm
> hardly an expert, but what about various anti-Irish ("Croppies lie down"),
> Scots, French, Welsh, etc. perspectives?
>
> Steve Corrsin
________
Subject: Re: Was: Mrs. Reeves has the goods - & Folk Music?
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 17 Mar 1999 08:37:23 -0400
Content-Type: text/plain
Quoth Paul Draper>
> Not exactly. C always appears in the same place on the stave unless you
> are transposing to make it easier for another instrument to read. This
> is not the same as changing the key as the C in the key of G is still
> the same C as in the key or C or F etc.
>
Not from the Pythagorean standpoint. And clearly, not all folk musicians are
equally tempered. (nor equally humored, as Mr Tunnicliff has been reminded).
I believe that Mr Holmes, and Humpty Dumpty, have the actual definition of
Folk Music. Confusion only arises because we have five billion Humpty
Dumptys on the planet. There was one last night on the telly, advertising a
CD collection called A Treasury of Folk Music, or some such. It featured
Michael Row the Flowers Gone Kumbaya had a Hammer and other 'classics.' Nary
a McColl, Guthrie, or Lloyd. Certainly not a Copper, Jordan, or Waterson.
Definitely not a Dvorak, Glincka, or Beethoven in sight. This was Folk Music
from the big Folk Music scare (when it nearly caught on). It was a brief
flirtation with these 3-chord masterpieces that lead me to Child ballads,
Music Hall, and Capriciously capitalized Morris Dancing. Blessed be it.
--
Nick Robertshaw
I was carded once when I was 19. I gave the guy my driver's license, which
of course had my date of birth printed on it. He looked at it and said, "You
have to be 21 to get in here." I replied, "That ID is a few years old." He
looked at it again for a moment, then said "Oh, OK" and let me in.
________
Subject: Re: Buttered Peas revisited
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Tue, 9 Mar 1999 13:29:15 -0400
Content-Type: text/plain
Hmm. I'd say it'd probably get you tarred and daffoldilled. Here it is
beside the original.
--------------------------------------------------
My hen laid a haddock, one hand oiled a flea,
Mae hen wlad fy nhadau yn annwyl i mi,
Glad farts and centurions threw dogs in the sea
Gwlad beirdd a chantorion, enwogion o fri;
I could stew a hare here and brandish Dan's flan,
Ei gwrol ryfelwyr, gwladgarwyr tra mâd,
Don's ruddy bog's blocked up with sand
Tros ryddid gollasant eu gwaed.
Dad! Dad! Why don't you oil Auntie Glad?
Gwlad, Gwlad, pleidiol wyf i'm gwlad.
Can't whores appear in beer bottle pies?
Tra mĂ´r yn fur i'r bur hoff bau,
O butter the hens as they fly!
O bydded i'r hen iaith barhau.
---------------------------------------------------
It really isn't necessary to learn anything so byzantine to annoy them. At
Cardiff Arms Park,
Whales! Whales! Bloody great fishes are whales.
They swim in the sea; we have them for tea
Oh bloody great fishes are whales.
seems to work quite well.
--
Nwch Rwfertshaur
ParaGlyff.
http://www.paraglyff.cwm
________
Subject: Re: "Conkers" and "Pick-up Dancing" (NMC)
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Sun, 28 Feb 1999 17:11:42 -0400
Content-Type: text/plain
In spite of extravagant copyright claims by people who might have put these
gems up on a web page, I believe that most of them originated as entries in
a contest in The Spectator (or was it the New Statesman?).
I also recall...
And if you get hungry on your London excursion, you may choose a free piece
of fruit from the attractive samples displayed on street carts.
The British like 'queuing' for things but don't expect visitors to do the
same. Just wave your passport and go directly to the front of the line.
Don't tip taxi drivers. It insults their professionalism. If you respect
then in this manner, they will show their appreciation by giving a
delightfully colourful demonstration of 'old cockney'.
--
Nick Robertshaw
ParaGlyph. 301 694 8604
http://www.paraglyph.com
----------
>From: Nick Oliver <olivern@WAVERIDER.CO.UK>
>To: MORRIS@LISTSERV.IUPUI.EDU
>Subject: Re: "Conkers" and "Pick-up Dancing" (NMC)
>Date: Sun, Feb 28, 1999, 3:36 PM
>
> Further tips for tourists -
>
> Have you tried the famous echo in the Britsih Museum Reading Room?
>
> Nick
_________
Subject: Re: World Pancakes, hen ovulation traditions (NMC)
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Thu, 4 Feb 1999 09:52:53 -0400
Content-Type: text/plain
>
> Oh, me too! Pancakes have no religious connotations nowadays,
> anyway, if they ever did. I'm suspicious of the usual explanation that
> they used up ingredients not allowed in Lent,they're hardly
> luxury stuff. _I_ wonder if eggs weren't eaten in Lent to give the hens a
> chance to rear some?
>
I suspect it was more of a case of 'making a virtue of a necessity'. Before
the breeding of modern egg machine hens and the advent of artificially lit
hen-houses, eggs were unavailable in the winter anyway because real hens
stop laying. So if you had any left by Shrovetide you better eat them up coz
they'll be addled soon.
Old breed hens begin to lay again as the days lengthen, usually around
Easter. After the dark months of old-eggness, followed by total egglessness,
the delight of finding the first new-laid egg of the season was cause for a
celebration.
Of course, that celebration was called Easter, named after estrogen, the
eggy hormone. The celebration was later co-opted by the followers of Ishtar,
one of several invented religions.
[WARNING: One of the previous paragraphs contains spurious information]
Nick Robertshaw, FBMM 4mn
_________
Subject: Who's Sod?
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Fri, 22 Jan 1999 10:38:57 -0400
Content-Type: text/plain
Dear MDDL:
Any facts or speculation on the following:
Does any team lay claim to the Isle of Mull as its dancing turf?
Are their any teams currently operating in Scotland?
Nick Robertshaw, Foggy Bottom Morris Men
"Calling atheism a religion is like calling perfect health a disease"
_________
Subject: Re: Cecil Sharp---where are the bodies buried?
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Thu, 14 Jan 1999 11:10:05 -0400
Content-Type: text/plain
He autocratically declared his own views to be the only acceptable views and
worked to undermine those who opposed him by means of personal attacks.
He filtered the material he collected and presented that which he declared
'typical' as being the only material of merit while suppressing that which
he declared "atypical" or "degenerate", thereby creating a generation of
dance teachers who were mislead about what they vehemently were teaching was
the 'correct' version of "the tradition".
He declared the 'folk' to be unfit custodians of their own culture, took it
from them and sold it to the middle class.
Ms Boyes has all these charges written up in The Imagined Village.
I would distill them thus:
He was a Victorian when he should have been a Modernist.
--
Nick Robertshaw
ParaGlyph. 301 694 8604
http://www.paraglyph.com
>
> C'mon gang, someone's holding out on me, this isn't enough to make
> him the bogeyman he's become, what's the real poop? Obviously it
> can't be verified or it would be written up and I'd know about it,
> that's fine, I'm just looking for gossip and rumours here. Satanism,
> nazism, perversion, murder, drugs, what was it? You can tell me,
> can't you?
>
> Matthew
________
Subject: Re: Boxing Day
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Mon, 21 Dec 1998 08:23:00 -0400
Content-Type: text/plain
In the US, Boxing day is celebrated by taking all the gifts you've received
back to the store to exchange them for something you actually want, or that
is the correct size. The store will only agree to the exchange if the goods
are in their original box, hence Boxing Day. Also associated with this
tradition are TV re-runs and the need for sales documentation; hence the
ubiquitous:
I'll need the receipt sir, said Sculley to Mulder,
etc.
_________
Subject: In comes I, a marching band in Vegas costumes
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Fri, 18 Dec 1998 09:32:17 -0400
Content-Type: text/plain
For those on the list unfamiliar with New World traditions, on New Years Day
there is a huge parade in Philadelphia of marching bands and clowns, sort of
a 76 trombones meets Mardi-Gras affair. The costuming is extravagant and
competitive (and completely reworked every year), the traditions of who may
participate well established. Follow the links from www.mummers.com to view
pictures of last years events.
This is 'mummers' to most Americans that have heard the word. While it might
be misrule, it lacks any hero-combat, or quackery element. It might be
viewed as a quete of considerable length.
It shares common ancestors with the trusty British 'Income's Eye' mumming,
at least etymologically. The explanation at
http://www.fieldtrip.com/pa/53363050.htm
hints at this.
Enjoy.
________
Subject: Re: sword black face
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Tue, 1 Dec 1998 08:40:12 -0400
Content-Type: text/plain
----------
>From: "Jennifer Brooks (Apple Tree Morris)" <brooksj@WELLSFARGO.COM>
>To: MORRIS@LISTSERV.IUPUI.EDU
>Subject: Re: sword black face
>Date: Mon, Nov 30, 1998, 7:52 PM
>>
>I thought that minstrels in blackface were *white* people. I know that at
>least sometimes that was true, and I had the impression that it was always
>true. (My dictionary uses the phrase "usually white", but of course, this
>particular dictionary was not written by God, unlike some others that I've
>seen referenced.)
>
>(That was irony, son, irony.)
>
>Jennifer
Here's a rare but notable exception.
James Bland, a black American, born 1854 wrote "Oh Dem Golden Slippers" and
"Carry Me Back to Old Virginny" (now Virginia's state song). He abandoned
his law studies at Howard University to sing his songs with a minstrel
troupe.
It was required for black people to black up when performing as minstrels
!!!
In 1881 he left for Europe where it was OK to be a minstrel without the
burnt cork.
Nick Robertshaw
_________
Subject: Re: Session
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Fri, 20 Nov 1998 16:31:11 -0400
Content-Type: text/plain
>>Personally I find non-dancing musicians an anathema. It is very rare to
>>find a good one (if ever). I can always tell if the musician is a
>>dancer or not, especially when I'm dancing. It has a big impact on the
>>dance.
>>
>>Why don't these folks dance? What is frightening them?
>
Well, I believe that prejudice can be pretty scary, perhaps that could be
it.
Interesting that the Kirov, Royal Ballet, Bolshoi, Riverdance, Alvin Ailey,
and all other professional dance companies seem disinclined to demand that
their musicians also dance. Perhaps it's not anathema to them. Or maybe they
use those little wheezy inhalers to control the anathema.
Nick Robertshaw
Foreman, dancer, musician, anathema sufferer.
________
Subject: Re: An apology for using the term Celtic (NMC)
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 11 Nov 1998 20:05:38 -0400
Content-Type: text/plain
>
>> I just think that, as regards
>> contemporary music, the term Celtic is at best meaningless,
>> at worst marketing pap. SO there.
>
>So, let me just check. When someone asks "Will there be any Celtic music at
>Folk Festival XYZ," you truly, sincerely, don't understand what the question
>means? It's exactly equivalent, in terms of your degree of comprehension,
>to "Will there be any Kworkblurfl music at Folk Festival XYZ?"
>
Kewl!
You guys have Kworkblurfl music in Hastings now?
Nick Robertshaw
________
Subject: Re: Souling in Vancouver
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Mon, 2 Nov 1998 15:23:23 -0400
Content-Type: text/plain
>...reams of Normanic ecstasy deleted...
>
>Of course, nobody, not even the VMM, are doing this, so its all just a
>figment of my over-active imagination. All I am left with is the question -
>why is this seasonality so very difficult to understand?
>
>
>
Perhaps because we've air-conditioned away the heat of the Summer; Centrally
heated out the raw, damp, cold of Winter and electrically illuminated its
darkness; flown in antopodean market crops so that blander versions of the
seasonal delights of June strawberries, April asparagus, October persimmons
are offered year round. Plus, many of us are distanced from the
church-imposed round of Advent, Christmas, Lent, Easter, Whitsun, Trinity,
or the agricultural cycles of ploughing, lambing, planting, haymaking,
shearing, harvesting, foxhunting.
We are periodic by nature (the Rhythm of Life is a Powerful Beat) but much
that used to mark our seasonality is gone.
Of course, as individuals the Old Dead Guys didn't do it according to
Norman's Shining Vision either. Just a bit o' stoat cudgelling on Saint
Swithin's like their fathers done before 'em.
________
Subject: Re: Sharp and EFDSS (also Long and rambling)
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 7 Oct 1998 08:55:56 -0400
Content-Type: text/plain
>
>I am led to wonder (with Danny Stradling) why we have the Ralph Vaughn
>Williams Library and Cecil Sharp House, but no monument to Merry Kimber or
>John England. Possibly a question of motivation vs. substance.
>
>
>Peter Klosky
>BinghamtonMM/BFHarridans/AmericanTravellingMorrice
C#'s intransigence regarding 'the morris way' seems no greater than
Kimber's. Perhaps also his structure for teaching morris, and being
qualified to do so, builds as much upon the apprenticeship tradition
that Kimber would have understood as the proper way of learning
a trade. (Will would probably not have tolerated either your
approach or mine to the concertina, Peter). So making the
apprentice perfect Bampton before graduating to the journeyman
Ilmington dancer before attempting to be the Master, capable
of flawlessly executing Sherborne seems much more likely to
stem from trade apprenticeship (working class, as perceived then)
than pedagogy (middle class).
Merry Kimber has a fine monument in the Headington churchyard
(just a few parking spaces away from C.S. Lewis). It might just
last longer than that barn in Regents Park.
________
Subject: Re: Toasts, Orange & otherwise (NMC)
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Sun, 4 Oct 1998 10:00:17 -0400
Content-Type: text/plain
Ah, but 'twas not King Billy's own horse, but one he 'acquired' by executing
for
treason its owner, Sir John Fenwick. The horse was a Barbary named White
Sorrel which
obviously conspired with the mole to avenge its former master.
So the air "Sir John Fenwick's the Flower among them All" can also be used
to
express Jacobite sympathies.
The name of the Gentleman in Black Velvet, like that of all good moles, went
unrecorded.
>
>As to William of Orange: after King Billy's successful Battle of the Boyne
>saved the people of Ireland from Knavery, Popery and the vague prospect of
>self-governance, this Glorious, Pious monarch (no, Bill Brown, he was not a
>butterfly) turned his attentions to the European wars of Succession. Whilst
>riding at Hampton Court, King Billy's horse stepped on a mole-hill and threw
>him, breaking the royal collar-bone. Complications of this and other injuries
>killed the king.
>
>So... for the next 100 years or so, a popular toast for those with Jacobite
>sympathies was:
>
>"To the wee gentleman with the velvet coat."
>
________
Subject: Re: English Traditional Dance
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Thu, 3 Sep 1998 17:37:17 -0400
Content-Type: text/plain
>>Over the years we have dubbed the dances we have organised at the
>>village hall variously:
>>Barn Dance, Family Barn Dance, Hoe Down, Halloween Ceilidh or
>>whatever, changing the name to suit the style of the band and to make it
>>sound a bit different from the one six months ago.
>
I suppose in these days of mechanized farming, a 'Hoe Down' ought to be
called a 'Tractor Off'.
Nick Robertshaw.
Foeman, FBMM
________
Subject: Re: traditional english dance
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Thu, 3 Sep 1998 08:59:00 -0400
Content-Type: text/plain
>
>Forgive my ignorance, but what part of England does the
>word Ceilidh come from? My understanding is that it is
>Gaelic for dance, making a ceilidh dance a dance dance.
> Sorry for blatant pedantry, but having recently
>taken some flak for being a Scottish Morris dancer (and I
>quote "Haven't you got enough culture in Scotland?" And we
>were sober!), I thought I'd stick my oar in.
> Ken
It comes from the part of England known as Ireland and Scotland.
(!!??**&$%^)
The word is Gaelic for visit.
________
Subject: Re: traditional english dance
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Fri, 28 Aug 1998 10:37:05 -0400
Content-Type: text/plain
The English style of Ceilidh is rare to absent in the Eastern US. The
characteristics, some of which have been mentioned, are:
Community dances, often 'easy', mostly later than Playford, often with
implied regional origin (Nottingham Swing, Cumberland Square eight, Faucet
Door Hand Reel, Waves of Tory, Blaydon Races, Morpeth Rant). Circle dances
(with Circassian Circle the traditional farewell dance of the evening),
progressives and mixers.
ATTACK of the dances: panting and sweating (even for the young and fit)
Cooling-off periods where the dancers are entertained by billed guests,
floor singers, band sets, or even displays by a Morris Team!!
A ready supply of alcoholic beverages.
Dancers attending American ECD, Contra, and dance camps would not be
expecting any of these.
_________
Subject: Gardiner and Needham
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Tue, 18 Aug 1998 10:45:14 -0400
Content-Type: text/plain
Sidestep right; sidestep left.
Now it makes sense.
Nick Robertshaw
________
Subject: Paging Jordan Heron... (NMC unless you're Jordan)
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Fri, 14 Aug 1998 17:16:54 -0400
Content-Type: text/plain
"Jordan Heron, please send Bruce Henderson an Email message at
bhenders@landrover.com re- the BlueMont Ale"
Nick Robertshaw
________
Subject: Mornington Crescent. Closed for Rebuilding
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 5 Aug 1998 14:28:24 -0400
Content-Type: text/plain
>Okay, someone referred to some British radio quiz show (I think) or
>other. Now, I love those things when I get to hear them, which is
>rather occasionally, when I'm listening to Canadian radio via one of my
>local public radio stations. But I'm hardly familiar with all of them,
>and have *no* idea what y'all are talking about!
>
>ISIHAC????
>Morningstar Crescent????
>
>I'm really interested, and so is Jon Berger. And yet, in the face of
>his willingness to admit utter ignorance, he has been cruelling brushed
>off. Now, Jon tried bravely to jump into the game. I'm just gonna
>grovel. Please, please, will someone explain these things to me, who am
>genuinely interested but rather puzzled?
>
ISIHAC = I'm Sorry I Haven't A Clue. A BBC radio panel game (1970s) in which no
rules are ever explained or winner declared. The panel is composed entirely
of professional panel game players (Willie Rushton, Frank Muir, John Amis
etc.)
Mornington Crescent. One of the regular games from ISIHAC. Players take it
in turn
to name stops on the London Underground (a subway system, not an escape
route for
English slaves). The winner is the first person to get to Mornington Crescent.
Players make reference to obscure and byzantine rule to justify their choice of
station (or challenge the choice of others). Since the actual rules are
never disclosed,
the audience is left with a suspicion that the players are simply naming
tube stops
at random. But it all seems so *Earnest*.
Mornisgstar Crescent. A version of Mornington Cresent where the stations are
Morris- related puns on the names of London Underground stations. So if you
want to
play, you'll need an underground map (see
http://www.jle.lul.co.uk/misc/tube_map/).
Mornington Crescent can be found in the top middle map segment. It is
currently closed for
rebuilding.
Arrivals at the XXXX ball.
Perhaps you've figured this one out from watching the game in progress on
the MDDL. It is also from ISIHAC.
So you see, there is less to this than meets the eye.
Nick Robertshaw
________
ubject: And still they came...
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 5 Aug 1998 10:23:59 -0400
Content-Type: text/plain
A giggle of debs:
Mr and Mrs Pipes and their daughter Becca;
Mr Fusride with their daughter Sherry;
Mr and Mrs Rulmonks-March and Jenna Rulmonks-March;
Mr and Mrs Wersoff-Edinburg and daughter Flo;
From China, Mr and Mrs Tso Blu, and Bonny;
Mr and Mrs T'Leon with their newborn, Wee T'Leon
Oh, and leaving us, Mr and Mrs Deldiss and their daughter Heidi!
Al Gowan, Ann List, Vera Sailor...
Mr and Mrs DeLite, and their son Quincey
And finally (don't you wish), Mr and Mrs Perupp and daughter Kay.
Nick Robertshaw
________
Subject: Late arrival, by tube
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Tue, 4 Aug 1998 15:52:08 -0400
Content-Type: text/plain
Please welcome Mr and Mrs Ingstar, and their daughter Maud, who has a bad cold.
Nick Robertshaw
________
Subject: Guests arriving at the Morris Ball
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Mon, 3 Aug 1998 11:08:58 -0400
Content-Type: text/plain
Ladies and Gentlemen, welcome please Mr and Mrs Toothafair and their
Scottish son,
Jock E. Toothafair
Presenting Lord Spleasure. Oh, yes. and Lady Spleasure.
And of course, Mr and Mrs Lington-Lammale and their son Kurt.
(who started this?)
Nick Robertshaw
________
Subject: Morningstar Crescent
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Mon, 3 Aug 1998 09:39:27 -0400
Content-Type: text/plain
Old Molly Oxford Circus
Nick Robertshaw
________
Subject:
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Sun, 26 Jul 1998 17:16:44 -0400
Content-Type: text/plain
For all those who requested the words and music to the song Hot Meat, you
can now find both on a web page at:
http://www.paraglyph.com/pgweb/hotmeat.html
Those affected of great sensitivity should not visit.
I am enthusiastically grateful to Bill Brown for the tasteful (considering!)
illustrations. Copyright and performance questions are answered on the
linked copyright page.
I am also grateful to the deluge of unsolicited email of the same name that
inspired the song.
Nick Robertshaw.
________
Subject: Re: Dancing to...
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Sun, 19 Jul 1998 09:37:08 -0400
Content-Type: text/plain
>On Sat, 18 Jul 1998, Nick Robertshaw wrote:
>
>> And for 150 bonus points, what is the technical name for a set of tunes that
>> can be played simultaneously e.g., Pachelbel Canon and 'When a man loves a
>> woman."
>>
>Quodlibet
>
Congratulations. Your prize points may be redeeemed at any of our
fabulous prize redemption centers.
Choose from any of the following fabulous prizes:
An eternity in a paradise of your own imagining.
A five-meter cube of invisible, weightless gold.
A 1997-1998 bound set of 'Concertina and Sqeezebox' magazine.
"The True Origins of Morris Dancing--A controversy ended" by Corrsin,
Stanfield, Forrest, Heaney, et al.
A breeding pair of Unicorns.
Nick Robertshaw
________
Subject: Re: Dancing to...
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Sat, 18 Jul 1998 10:11:37 -0400
Content-Type: text/plain
>I don't know if this has covered before but it is fun to dance Highland
>Mary...
>...Jamaica Farewell,
>...Beethovens 9th last movement
And for 150 bonus points, what is the technical name for a set of tunes that
can be played simultaneously e.g., Pachelbel Canon and 'When a man loves a
woman."
Nick Robertshaw
________
Subject: Old Dead Guys Bells
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 24 Jun 1998 10:46:18 -0400
Content-Type: text/plain
Of course, If anyone wants to examine William Kimber's bells,
the real ones can be found six foot below the limestone replicas.
Don't bother looking for the Jeffries Anglo there though.
Nick Robertshaw
________
Subject: Re: The Battle For Christmas
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Thu, 18 Jun 1998 09:22:53 -0400
Content-Type: text/plain
>
>Yes, but what *is* the most likely explanation of our dances, and our
>mummings origins?
>We had this discussion 6 months back - what goes around, comes around
>
A word from the 'Shut up and Dance' school.
Perhaps it's simply in our nature. Some sort of equivalent of Morris seems
to exist in most, if not all, cultures. Those who don't partake of the
Morrisesque are often drawn into community theatre, chorales, Sealed Knots,
MGB Owner's Clubs and so on where they exhibit their rehearsed like-mindedness
to a bemused public.
We're human. We dance for joy. We perform irrational acts for fun. We invent
gods to worship. The origin is probably in the middle third of the long arm
of chromosome 12 and begins:
tgctggtatttggttgcctaaaaaccatagttttagttattttcctatgttgctattata
aaggtgtaattgtcagattgagagacaagacacacatattatttaatagtttgtttatct
gagtcacagcatatagatgcataggtgagagagtgctttagatcttgccctgggccctac
Once genomicists actually identify this piece of code, we will all be able
to look forward to morris dancing tomatoes becoming available.
Elsewhere is the coding for the desire to speculate endlessly and
hopelessly about dance origins.
In other words, if Morris didn't exist, we'd have had to invent it.
Nick Robertshaw
_________
Subject: Re: The Battle for Christmas
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 17 Jun 1998 10:49:35 -0400
Content-Type: text/plain
>..Christmas
>used to be a time when peasants, poor people, servants, etc. were
>legitimately able to "hit up" the rich people for gifts and money--using
>various cadging techniques from caroling to ritual demanding.
>
>.. this is what was
>surpressed by the Victorians because they were threatened by aggressive
>cadging.
Sounds like the 1040 (that's a tax form, O transatlantic brethren and sestren)
on January 2nd is a continuation of the same tradition. Ah for the good old
days when the NSA and the DHHS would drop by and perform a sword play for their
funding, the Department of the Interior (responsible for the exterior!) would
cadge after their mummers play.
"Now first to come in is the Office of the Inspector General"
"In comes I, the Bureau of Land Management"
Nick Robertshaw
________
Subject: Re: getting off
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 3 Jun 1998 15:55:01 -0400
Content-Type: text/plain
>
>Any relation to a song by Pete Coe about the bible sold to buy a new bear?
>
>Yes, learned from the singing of our own Dr. Tony Barrand and John Roberts
>and, for those who aren't aware of the song, the tune (as I think of it) is
>"Swaggering Boney". Is there a "real" name to that tune (e.g.: I think of a
>certain dance as The 3 (or 4) Musketeers, or Simon's Fancy, but the "real"
>name of it is....different, and escapes my mind right now.)?
>
Swaggering Boney = Old Frog Dance (actually, these titles are the same. You
figure it out!) = Travel By Steam.
94.6 percent of statistics are made up on the spot.
Nick Robertshaw
________
Subject: Ewe look! No, Ewe.
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 13 May 1998 19:15:50 -0400
Content-Type: text/plain
>
>Hardly un-pagan/un-morris Mary Beth. Pre-Christian feast days/holidays
>were moveable from one year to another and from village to village.
>Imbolg, for example, is now celebrated on or around February 2nd,
>(Candlemas) but in Ireland was celebrated when the first ewes were
>lactating. I'm sure that they didn't all start lactating in the same
>week in every region. Regional differences were common in the
>celebration of some of the holidays including Beltaine and/or "May Day".
>
>My feelings are this - I don't care when you celebrate it - JUST DO IT.
>And when you're done be sure to have a few pints!
>
>Regards,
>Doreen
Was that a specialized job, the ewe lactation inspector, or could just
anyone do it?
Ah, sweet embraceable ewes.
Nick Robertshaw
________
Subject: Re: Out of the mouths of babes and sucklings!
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Mon, 11 May 1998 09:05:50 -0400
Content-Type: text/plain
Greg. T. proffered the assumption:
> I am, of course assuming this is NOT the same Eliza Carthy who is a
>folksinger, and has married into The Watersons?
Her father married into the Watersons; she was born into them.
As the horsists say "Out of Norma, by Martin"
Nick Robertshaw
________
Subject: Re: Cake !!WARNING!! Language incompatibility
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Tue, 5 May 1998 09:43:00 -0400
Content-Type: text/plain
> recipe? Can you use fancies or must it be a big slab of fruit cake?
Beware of a knickers/breeches-waistcoat/vest type problem.
The English fruit cake, the robust Dundee and it's ilk, is almost
universally enjoyed and respected by the English.
Not so the...
American fruit cake, a sticky brick of mysterious red and green
sugary waxes topped with pecans and sweetened glue, almost
universally abhorred and despised by Americans who mail it
to each other at Christmas purely for the enrichment of The
Postal Service.
Nick Robertshaw
________
Subject: Re: sword-bearing
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Tue, 5 May 1998 07:58:53 -0400
Content-Type: text/plain
>At 1998-05-04 16:52, Stanfield wrote:
>
>>What do you do in this day and age when everybody is so health-conscious,
>>and does *not* want you handing them a piece of fruitcake with your bare
>>hands. I'm not fanatical about this, but after learning the facts of the
>>matter, I don't ever take anything served with bare hands. Modern times.
>
>How do you feel about the Christian Eucharist, or if you're not a
>Christian, how would you if you were?
>
When my son first witnessed this display of theophagy, his (audible)
response was:
'Eeeuuww!'
Nick Robertshaw
________
Subject: Re: May Nuts
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Thu, 30 Apr 1998 16:28:10 -0400
Content-Type: text/plain
>There is of course the sexual
>meaning, but I'll leave that explanation to somebody else. Besides I don't
>believe it.
>
>So the tradition is that the young women go out to the fields "at break of
>day" and gather flowers for the nuts and garlands to be displayed (for the
>purposes of cadging), or left on doorsteps, later in the day. They could
>also wash in the dew of the hawthorn tree ("and ever after, handsome be")
>while they're out there. And I suppose, this distinctly woman's tradition
>was probably invaded by expectant young men, perhaps with very little protest.
>
For a full guarantee of 'fairness', the maidens had to be
*Rolled* in the dew on a May morn.
Nick Robertshaw
________
Subject: Re: Women don't dance Cotswold (2)
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Thu, 23 Apr 1998 08:55:14 -0400
Content-Type: text/plain
Opined Ian Cropton:
>attitudes on the issue. And the recent all-male DoD organised by
>Binghampton MM suggests to me that sexism is
>still to be found hereabouts.
>
This seriously misrepresents and misinterprets Binghamton's Gilbertsville
tour weekend. It is simply an annual tour for B'ton and TFMM with one
additional team invited from the nearby handful that are prepared to
associate with such reprobates. Together with the Suds, it is certainly a
guys' tree house (significantly enriched by the presence of Roberta and
Maggie) but that is no more sexist than holding a horse race is horsist.
Women's Morris and Mixed Morris exist and require no validation. Those who
see that men's morris also has value don't need to be branded sexist.
Nick Robertshaw
________
Subject: Re: Bear Ale/muso etiquette
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Mon, 20 Apr 1998 10:27:37 -0400
Content-Type: text/plain
>
>One thing did happen over the weekend that bothered me, ...
>
>My side, Pennyroyal, was performing and Linda Kodaira and I were playing.
>After the side began the dance, I heard
>a voice behind me ask "is this the same tune we use for Bampton?", then I
>heard another fiddle start playing. As best I could (I have trouble playing
>fiddle and t-t-talking at the same time), I turned around and said "please,
>no", then turned back to the dance. He stopped playing.
>
>
>I thought that maybe nobody had ever explained Ale etiquette to
>him, so I told him the rules as I understood them. He told me yes,
>he knew some people felt that way, but he was
>"lobbying against" that thinking. He said that the purpose of Ales should be
>for us all to play and dance together, and that unless specifically asked not
>to, any musician should be welcome to join in at any time.
>
>
>David James
>Pennyroyal Morris
Well, I don't know how things work over there in nice polite California,
but Back East this perp would have had his fiddle fitted rectally.
Check with your local ordinances, but I suspect homicide might even
be justifiable.
Are you still seething with rage?
Nick Robertshaw
_________
Subject: Re: THE HISTORY OF MORRIS DANCING - Book
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Mon, 20 Apr 1998 10:18:23 -0400
Content-Type: text/plain
Synchronicity.
John Forrest is the overseas Archivist of the Ring (write to him if you need
copies of stuff from the ring archives). I have known John for more than 30
years but not seen him for 25. He is currently inactive except when he is able
to dance with The Ancient Men (Oxford Univeristy Old Guys). He was (and
perhaps is
still) a fine dancer. He has also danced with Bath City, Herga, Abingdon,
and Datchett.
At my suggestion, he showed up to spectate and renew acquaintances at the
Binghampton Men's most excellent Gilbertsville tour this very weekend,
probably just as Doreen was forwarding her inquiry to the MDDL.
He does not frame his opinions to agree with all others but for some
this makes for better reading. I would not take too seriously the
grumpy reviews of others who claim proprietorship of the Only True
Knowledge.
I suspect his book will suit neither the impatient or the 'shut up
and dance' mindset. It may be very useful to those who wish to have
a guide to the extant archive material.
$65 could buy a barrel of beer. It's a tough choice.
Nick Robertshaw
________
Subject: Re: Uplifting moments
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 15 Apr 1998 18:41:59 -0400
Content-Type: text/plain
>Norman worried:
>
>Which brings to mind a small but crucial detail I would like to explore
>here. Occasionally the VMM have hoisted a female volunteer, and she has
>instantly collapsed by sitting down, obviously a gut (and sensible) reaction
>to the surprise of being lifted.
>
>So how do we prevent this occasional problem? Or to put it another way, what
>is the strategy that your team has devised to successfully perform an Easter
>Lifting/Heaving episode? How do you get them to "stand up"? How do you avoid
>potential embarrasements when grasping her? Or do you bother to think about
>it all?
>
Er, the standing up can be induced as a reflex in the female. I'll leave it
to you to devise a suitable series of experiments to discover how to trigger
the reflex. You will need one female volunteer for each iteration of the
experiment
(and possibly one lawyer).
When Herga Morris lifted Isla St. Claire on the BBC's Generation Game, we
demonstrated this reflex rather well while also discovering where her radio
mike transmitter was concealed. We avoided *potential* embarrasements by going
for *guaranteed* embarrasements.
Where is Isla these days? Probably more a candidate for Old Woman Tossed Up
in a Blanket.
Glad I haven't aged a bit.
Nick Robertshaw
________
Subject: Re: Shakespeare pipe and tabor
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 15 Apr 1998 13:40:29 -0400
Content-Type: text/plain
>
>As far as I know, the only character that actually plays the pipe and tabor
>in all of Shakespeare's plays is Ariel (Tempest: III, ii, 123 and 149), but
>it is mentioned often enough to make it a household fixture.
>
In the Winter's Tale, the Old Shepherd is told at the sheepshearing
party:
"If you could but hear the pedlar at the door, you'd never dance again
after the tabor and pipe"
The pedlar was Autolycus and his performance was presumably an a capella
vocal act. He would, of course, have played a concertina but it hadn't
been invented.
Of similar rambing irrelevance...
The concertina became a popular instrument for young ladies to play in the
Victorian and Edwardian eras because it was the only instrument, other than
the piano, that was not considered 'improper'.
Bowing a violin caused distracting movement in the chestal area
Putting a wind instrument to the mouth produced indelicate salivary
biproducts (and would conjure lewd thoughts in an incontinent and
impressionable male)
Grasping a 'cello between the thighs was obviously only something a 'fallen
women' would consider.
But the concertina can be played without drooling, with your knees
together, and your tits immobile. I must try this sometime.
Nick Robertshaw
________
Subject: Re: Isle of Man: folklore of a three-legged race?
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Thu, 9 Apr 1998 17:45:37 -0400
Content-Type: text/plain
>
>I wish you'd cut it out with this "England" and "Great Britain" and "United
>Kingdom" and "British Isles" and all that. Be like the United States.
>Fifty states; simple. Oh, and Puerto Rico. And Guam. And the District of
>Columbia. Do we still have Samoa?
>
Yes. And the Federated States of Micronesia, The Marshall Islands, Palau, The
Virgin Islands that everyone else calls the American Virgin Islands, and the
Northern Mariana Islands (which are delicious on seafood). I believe that
parts of Idaho still belong to the US too.
Nick Robertshaw
________
Subject: Re: Isle of Man: Land of Tripods and Motorcycles
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Tue, 7 Apr 1998 08:23:25 -0400
Content-Type: text/plain
Previously on MMDL:
>>What is this "Britain" of which you speak?
>
>When I tried asking the question around here, one "helpful" response was that
>"Britain" should properly include Brittany (part of mainland France).
>
Obviously, Britain also includes Cape Breton and its charming musical
Island and half the girls born in the US in 1983 (those called Brittany;
the others were all called Ashley).
Nick Robertshaw
_________
Subject: Re: Isle of Man: Land of Tripods and Motorcycles
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Tue, 7 Apr 1998 08:23:25 -0400
Content-Type: text/plain
Previously on MMDL:
>>What is this "Britain" of which you speak?
>
>When I tried asking the question around here, one "helpful" response was that
>"Britain" should properly include Brittany (part of mainland France).
>
Obviously, Britain also includes Cape Breton and its charming musical
Island and half the girls born in the US in 1983 (those called Brittany;
the others were all called Ashley).
Nick Robertshaw
________
Subject: Re: ditties for Three Musketeers dance
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Thu, 2 Apr 1998 11:40:34 -0500
Content-Type: text/plain
OK, i dredged through my box of word scraps and found "When the King Comes
Home in Peace Again" as collected from my sister in law, a former
Sealed Knot 'hor's de combat'. Clearly a Royalist ditty, Charles being
the Konk in question. Now if any English side knows two adjacent pubs
called "The Royal Oak" and "The Man in the Moon", you could probably get
a round on the house from singing and dancing it.
What booker can prognosticate
Concerning Kings or Kingdom's fate
I think myself to be as wise
As he that gazes on the skies
My skill goes beyond
The depths of the pond
Or rivers in the greatest rain
By which I can tell that all things will be well
When the King comes home in peace again.
There's neither swallow, dove, nor daid (?)
Can soar more high nor deeper wade
Nor show a reason from the stars
What causes peace or civil wars
The man in the moon
Could wear out his shoon
By running after Charles his wain
But all's to no end for the times will not mend
'Til the King comes home in peace again.
Nick Robertshaw
________
Subject: Re: ditties for Three Musketeers dance
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 1 Apr 1998 17:14:14 -0500
Content-Type: text/plain
>On Wed, 1 Apr 1998, Marc G. Lamb wrote:
>
>> Foggy Bottom MM dances Three Musketeers to the outstanding old tune "The
>> World Turned Upside Down." John Berger mentions using a 'weird variant' of
>> "British Grenadiers" for this dance, I wonder if this is in fact "The World
>> Turned Upside Down."
And Jon Berger wrote:
>Now that you mention it, though, the song on the Carnival
>Band CD would make an absolutely top-notch morris tune, so maybe that's the
>one you're talking about. It would work perfectly for "Three Musketeers":
>it's got a modulation to the dominant key at the beginning of the B part
>which would coincide with the sticking and sound really cool. I'll give it
>a try.
>
>According to the notes in the CD pamphlet, the tune is actually called "When
>the King Enjoys his Own Again," and the words seem to be about what a
>complete dog's breakfast the Parliamentarians made out of the celebration of
>Christmas.
That is indeed the tune that Foggy Bottom uses for "Thee Musketeers",
although we call the dance "The Cavalier". I learned the tune from
a bunch of Sealed Knot loonies (English Civil War re-enacters). They
called it "When the King comes home in Peace again".
Nick Robertshaw
________
Subject: Re: Dr Who's on First
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Mon, 30 Mar 1998 08:54:45 -0500
Content-Type: text/plain
>... The underlying metaphor, of course, is the inroads by
>modernism (represented by the Doctor) into even rural traditionalist
>society (represented here by the morris dancers). Here we have a
>celebration of modernism's then-apparent triumph in the latter half of the
>20th century--just as it's assumptions of pure objectivity, rationality,
>and Western scientific/philosophic superiority were beginning to be
>quesioned. No doubt you have already grasped the irony that in these
>post-modern times morris dancing thrives, while Doctor Who has been
>canceled--the ultimate de-construction.
>
That's exactly what I've always said about that particular episode.
Nick Robertshaw
________
Subject: Re: Flanders and Swann at an ale? (Was Woad)
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Mon, 23 Mar 1998 08:22:10 -0500
Content-Type: text/plain
Don't worry jOHN, plenty of ppl over here know the chorus and plenty
more are sharp enough to catch on after verse 2. I have been at Ale
tour pub stops over here where Flander&Swann became the song theme**. These
gems have been done, but to much less death than many other songs that
still get trotted out anyway.
>
>What I would like to know is this, please, MDDLers: If I sing "The
>Hippopotamus Song" at a North American ale, will enough people know the
>chorus to give me the opportunity for a sip of beer between verses? Or is
>it done to death anyway?
>
>jOHN of St Albans, UK
>http://www.users.zetnet.co.uk/jprice/
** And G&S, Moody Blues, Tom Lehrer...
Nick Robertshaw
________
Subject: Re: Diet of Worms
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Thu, 19 Mar 1998 11:23:16 -0500
Content-Type: text/plain
>I think most people would know what I mean.I guess I should specify by
>saying "whittle and dub",fiddle,button accordian and well played piano
>accordian.
> "Nobody likes me,
> Everybody hates me,
> I'm gonna eat some wooorms,
> Long, thin, skinny ones,
> Big fat,juicy ones,
> I'm gonna eat some wooorms"!
Yup, Merry Kimber was a reckless destroyer of tradition playing that
newfangled concertina for morris. It's a wonder that C# didn't dismiss
him as 'degenerate' along with all those Border dances.
"Bite their heads off
Suck all the juice out
Spit the skins away (hoch, pthew)
Nobody knows how much Dave thrives on
Worms three times a day."
Nick Robertshaw
________
Subject: Re: Brighton Camp chords
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Fri, 13 Mar 1998 18:32:08 -0500
Content-Type: text/plain
Gee, I usually play
C G, G C, G Em, G G, Em-D(f#) G, G C, C(G) G7, C G
G C, G Em, G Em, A D, C G, G C, D C, C G
...but then I'm a sucker for plagal cadences and 6/4s. I know this
is tough on melodion players that can't handle chord inversions.
Oh, and the words (for homecounties guttersnipes like me) were
Oh the black cat piddled in the white cat's eye
And the white cat said "Cor Blimey"
And the black cat said "O pardon me"
"I didn't see you standing behind me."
Nick
(books? they have chords in books?)
________
Subject: Re: new mddl member
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Fri, 13 Mar 1998 06:58:33 -0500
Content-Type: text/plain
>Yo, I'm finally here. Looking forward to lighthearted discussions,
>bandying banter and raucus debate with the rest of you morris junkies.
Welcome to the MDDL, David. Your opinions will be a welcome addition
to the next round of discussions on the correct motive for
bell tuning and the origin of Norman.
Nick Robertshaw
________
Subject: Midwest Ale
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 11 Mar 1998 11:45:44 -0500
Content-Type: text/plain
Would any team going to the Midwest Ale like to adopt me for that
weekend?
I am a musician/dancer with 30 years (argh!) experience in Cotswold,
Longsword, Border, and Northwest. Loud, punchy, Jeffries concertina
player (ambiguity intended). Lusty singing included.
I shall be in Colorado anyway.
Nick Robertshaw
________
Subject: Re: JK & the Bedlams (continued)
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Sun, 1 Mar 1998 11:05:50 -0500
Content-Type: text/plain
>> From: Nick Oliver <olivern@WAVERIDER.CO.UK>
>> To: MORRIS@LISTSERV.IUPUI.EDU
>> Subject: Fw: JK & the Bedlams (continued)
>> Date: 27 February 1998 22:12
>>
>> Hammersmith's style changed a lot during the mid-70's, and John's era
>there
>> was essentially the sixties (he was foreman for some time around 67-70,
>> succeeding Hugh Rippon), but I think he remained in touch well into the
>70s
>> and maybe later.
>>
>> Pre 1970, which is when I moved on from Hammersmith, we didn't do Upton
>at
>> all...
Hmm. If you're sure about this then the old brain's playin up. I recall
Hugh was foreman of the side in '70 and John K was an out-of-town member.
When Hugh left to go to Coventry, Jim Reynolds took over as foreman. Squire
succession was Buttercup, Daisy, Nick Blades. Then I married some chick who
didn't think I should belong to 2 sides so I had to give up H'smiff. That
would be 'round 73. But we didn't do Upton.
Trads were Longborough (the main trad) Bampton, Bucknell, Bledington,
Adderbury, Lichfield, Fieldtown, Brackley, Sherbourne. There were usually 3
or 4 sets dancing at practice, food fights at Ring Meetings.
Nick Robertshaw
________
Subject: Re: MORRIS Digest - 5 Feb 1998 to 6 Feb 1998
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 11 Feb 1998 17:56:07 -0500
Content-Type: text/plain
>As we have gotten on to naked morris dancers.
>
Perhaps I should remind people that nude mixed metal morris is available
for viewing at:
http://www.paraglyph.com/pgweb/studm.html
Nick Robertshaw
________
Subject: Re: Still - Foreman's Job
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Mon, 9 Feb 1998 15:27:18 -0500
Content-Type: text/plain
>Sorry to you all but I just had to answer this one
>
>Julie wrote
>>Oh, come on, John-tell me of one example where technical proficiency
>>would NOT enhance the look of a dance.
>
>Not quite as simple as that it just must take its place along with
>other choices.
Good response John and much to the point.
And thanks for clearing up the issue on what GWM stands for in your
part of the world (the abbreviation has significantly different meaning
in small newspaper advertisements in the US, and nobody had the courage
to ask).
>
>john
>Great Western Morris - Devon England
Nick Robertshaw
________
Subject: Re: Concertina lessons
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Mon, 9 Feb 1998 09:38:35 -0500
Content-Type: text/plain
As already noted, you need to figure out what sort of concertina your
father-in-law has so that you can sort the advice given on this list
according to relevance.
I suggest you get the instrument in front of you and consult the photos on
my concertina pages at:
http://www.clark.net/pub/bignick/indentina.html
I have heard all concertina systems used for morris except the Chemnitzer
(which would work just fine but certainly be a rarity). The Anglo system is
most usually associated with morris music (John Kirkpatrick, William
Kimber, etc) and might get you there quickest but the others are none the
worse for that. Note also that makers voiced their instruments differently
depending on their expected use. So if the f-i-l's concertina was built for
the stage or band playing it might be loud enough for open field morris but
if it was voiced to accompany the singing of some demure Edwardian lady in
her drawing room, it might be too timid to be heard over the bells (q.v.).
So, assuming there is no teacher-player in the vicinity that plays the
system you have in the style that you want, you're on your own. Sort of.
You might have to make use of the multi-instrumental husband unit (but
don't blame me if it results in a premature or unwanted divorce).
Generally, players approach Anglos and Duets as melody-plus accompaniment
instrument. So once you have figured out which buttons play what notes, you
can stumble through a tune on the right hand and vamp some chords on the
left. The guitar-playing husband should be able to tell you which chords
work where and what notes should be in, and on the bottom of, each chord.
The English system is usually approached as a fiddle proxy: essentially
melodic with double-stopping for added punch. So you should cozy up to the
fiddle/viola playing husband for pointers.
So here's your plan:
Find out what sort of concertina it is.
Get tapes of people playing morris tunes on this type of concertina (this
list will help you find them)
Figure out what you like to hear (and what you'd like to dance to) and get
the tipple-playing husband to work out what is going on musically.
Take a six-week sabbatical and practice for 10 hours each day.
Emerge triumphant with virtuoso performances of Constant Billy, Shepherd's
Hey, Flight of the Bumblebee, and Young Collins.
Now put those tears away.
Nick Robertshaw
________
Subject: Re: Bells
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Tue, 3 Feb 1998 13:54:41 -0500
Content-Type: text/plain
No, no, no.
Morris bells go on morris dancers
Cow bells go on cows
Bear bells are supposed to go on the bears
Take them off your shoelaces and tie them on some bears. That way everyone
hiking in Alaska gets warned when one of these bears is comimg.
'K?
>Several years ago I purchased very pure toned and LOUD steel bells
>from a outdoor recreational supply store; they were marketed as
>"Bear Bells" to attach to one's shoelaces to warn the bears that you
>are coming while hiking in Alaska. The four "bear" bells out perform
>the 2 dozen other brass bells on my pads. These are not the thin
>tinny steel bells that we know from christmas ornaments but high
>quality tempered steel bells that cost ~$4 each when purchased.
>Recreation Equipment, Inc. of Seattle is the supplier I purchased them
>from; but I am certain they are available elsewhere.
>
Nick Robertshaw
________
Subject: Re: Happy Birthday
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Sun, 25 Jan 1998 14:46:08 -0500
Content-Type: text/plain
So, Bill, you use the Internet to avoid using the Internet?
Go thou to
http://www.faqs.org/faqs/music/birthday-dirge-faq/
for definitive, canonical, compendious, comprehensive and thoroughly excessive
information on the subject.
Nick Robertshaw
________
Subject: Re: Happy Solstice
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Fri, 19 Dec 1997 11:59:44 -0500
Content-Type: text/plain
Bill Brown expounded:
>The Solstice is Dec. 21, this year, at precisely 15:07 (3:07 pm) EST, 20:07
>(8:07 pm) GMT.
>
>Perhaps you are under the misapprehension that I used to be under, that the
>Earth "wobbled" in its orbit ....
>
>To demonstrate this, let's do a fun science experiment! Imagine you are the
>Earth's axis with the Earth a spinning sphere around you--night and day,
>night and day, how jolly! You are standing in a room facing a large hungry
>polar bear, which represents the Sun...
Slow day, Bill?
You are obviously unaware that the International Federation of Sun Bears
has the exclusive right to represent the Sun in all animal dramatizations
of solar system phenomena. Or that the Polar Bear Cartel, OPB, is currently
under contract to Coca Cola for an undisclosed but presumed substantial sum
and are therefore unavailable for participation in science experiments.
Moreover, that to further their image as a kindler, gentler animal that
would be much more likely to give a bottle of Coke to a prey species such
as a harp seal rather than simply having them for lunch, OPB is currently
expunging all references to ursine predation and violence from the history
books (and therefore probably the science books too).
Anyway, there is a much simpler demonstration of seasonal precession using
a muddy soccer boot, a cucumber, two cathedral organs, and a roll of bubble
wrap.
To view a live video of this and talk directly to the soccer boot, enter
your AdultCheck password here:
User Name: ___________
Password: ___________
Nick Robertshaw
________
Subject: Re: Heads up Norman! - BRASS
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Mon, 15 Dec 1997 08:13:00 -0500
Content-Type: text/plain
>Today, while strolling in our local shopping area (MALL), I chanced upon a
>quilting friend of mine. She was quite excited to tell me that her son
>would be performing in the village green area (intersection of walkways)
>near a particular store at 1 pm, in a concert of TUBA's., etc.
A band of tubadors?
Nick Robertshaw
________
Subject: Richmondsheep (NMC, licensed for international pedantry)
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 10 Dec 1997 14:59:36 -0500
Content-Type: text/plain
>On Wed, 10 Dec 1997, J Price wrote:
>
>The temptation to point out that periods (and commas) following quoted
>material always go inside the quotation marks is almost too powerful to
>resist, but I'm a better and stronger person than that. Oh, whoops. I guess
>I'm not. Damn. That's what working as a law-review editor does to you.
>
English English and American English take opposite views on this. Americans
are taught to mind their Ps and Qs (Punctuate before Quote mark). Brits are
taught to put the full stop at the end of the bloody sentence. It's a
knickers and
vests thing (ah, got a morris reference in after all).
I'm still learning American from the natives. For example, after 17 years
in the USA,
I only just discovered that 'to shag' means to chivvy.
Nick Robertshaw
________
Subject: Re: Dilwyn's Not For Joe tune
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Thu, 27 Nov 1997 21:27:14 -0500
Content-Type: text/plain
>I suspect that the second verse (My Uncle Willy......etc.) was
>devised by Silurian (it certainly is their "style"), but I don't know for
>certain. Does anyone else?
>
The "my friend Billy" doggerel itself was common in English elementary
schools in the 50s and is probably much older. Silurian may have first
fitted it to the dance though.
Nick Robertshaw
________
ubject: Re: Dilwyn's Not For Joe tune
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Tue, 25 Nov 1997 14:34:57 -0500
Content-Type: text/plain
>I have a some puzzles on my hands. Can you help me out?
>
>The dance tune Not For Joe that we (and Silurian) use for Dilwyn is an AABB
>tune (my letters). This is how it is written in Stephen Baldwin's manuscript
>music, and in Karpeles and Schofield's little collection called 100 English
>Folk Dance Airs (p.28).
>
>However, Karpeles via the Bacon bible (p. 268) says it is BBAA (using the
>letters from my description above)!
>
>Cawte (EFDSS, 9/4 (DEC93): 201) describes the well-known song that is sung
>to Not For Joe, although the song is from Broseley, a hundred miles to the
>north. The notation of the song agrees with the Karpeles/Bacon arrangement:
>BBAA (chorus). (It is followed by one verse which seems to be a variation of
>the B tune.)
>
>And, just to muddy the waters even more, we (and Silurian) sing the tune
>backwards - B (verse), BBAA (chorus).
>
>So which is the right arrangement: AABB or BBAA?
>
Curious timing since I just last night put the tune up on the web.
It's at http://www.paraglyph.com/pgweb/notforjoe.html
FBMM begins Dilwyn with sticking, a chorus, which is normally danced to
B music but since it comes first is regarded as A music. So
the tune is adapted to the dance which begins in the middle
by calling the middle the beginning. The real question is where
was the beginning originally, at the start or in the middle?
Glad to have cleared this up for you Norman.
Nick Robertshaw
________
Subject: Re: Looking for Morris art
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 19 Nov 1997 08:22:44 -0500
Content-Type: text/plain
Ahem:
I have stayed on the sidelines of this one, mostly because I was recently
involved in a similar disagreement on another, graphics-related discussion
list. Like Peter did, I took umbrage to someone soliciting freebies from
artists and graphics designers, with and without their consent, and
responded in a very similar fashion. I don't recall an argument either for
or against that was not expressed in both debates.
An interesting note:
Quoth PK
>
>The electronic information revolution of the past decades has led to a
>mindset that expects immediacy in all things, usually at the expense of
>inconvenient (or costly) human involvement. It's a mindset that doesn't think
>twice about paying MS's Bill Gates but shudders at the prospect of paying
>FBMM's Bill Brown.
Bill Gates pays Bill Brown.
Bill does a lot of work for Microsoft, illustrating lead articles and often
the front page for their online magazine, Slate. I suspect that he's canny
enough to limit the usage so he won't see his work appear in a later MS
clipart collection.
Nick Robertshaw
________
Subject: Re: Souling
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Mon, 27 Oct 1997 09:25:48 -0500
Content-Type: text/plain
Well, Norman,
Throughout my years in north London, Fife, and Northants, I never ran into
any soulers among all the penny-for-a-guyers, guisers, whit-walkers,
bottle-scramblers, egg-shacklers and Fenny Poppers.
The practice of Are-souling is, however, rigorously followed by an
ever-growing population of Are-souls. They can be observed almost anywhere
but you are guaranteed to find them on the M25 on a weekday morning.
We have a quite a few Are-souls in the morris community.
Nick Robertshaw
________
Subject: Who Sabotaged the Brewer?
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Thu, 23 Oct 1997 11:03:38 -0400
Content-Type: text/plain
>
>>Some people
>>ascibe this as popular mythology, but the arguement is supported by the
>>french for clogs being sabots, and hence saboteurs.
>
>No it's not, and it is popular mythology. The word 'sabotage', according
>to Brewer's, comes from the great French railway strike of 1912, when the
>strikers cut the shoes (_sabots_) holding the railway lines.
>
>
>--
>Ashley Yakeley (Seattle Morris)
We can calibrate Brewer's usefulness for dispelling popular mythology by
looking up Morris Dancing in it. I'll save you the trouble. Quoth Brewer's
with confident authority:
"A dance, popular in England in the 15th century and later, in which the
dancers often represented characters from the Robin Hood stories. Other
stock characters were Bavian the fool, Malkin the clown, the Hobby Horse,
or a Dragon, and foreigners, probably moors or Moriscos. It was commonly
part of the May games and other pageants and festivals and the dancers were
adorned with bells. It was brought from Spain in the reign of Edward III,
and was originally a military dance of the Moors or Moriscos, hence its
name."
There you go. American morris is more traditional than English morris
because it always includes foreigners.
Nick Robertshaw
________
Subject: Re: Jolly Sheepskin History Question
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Mon, 20 Oct 1997 09:07:01 -0400
Content-Type: text/plain
Dear Dorothy:
All our traditional sources for morris dance content date from collectors
working in this century taking dances from informants whose memories might
reach to the middle of the last one.
Prior to the collection period there are references to dancing taking place
with some description of costume and music but nothing of steps or figures.
Three Jolly Sheepskins was not among the collcted dances (although Dr Cawte
noted that the Upton Snodsbury reel around 3 hats on the ground could work
as a sheepskin hey, there does not seem to be anything to indicate that
this is what the dancers originally did--the tune was 'Buttered Peas').
3JS morris dances are associated with the 1970s (re)construction of the
Border dances that surfaced as The Shropshire Bedlams and Martha Rhodens
Tuppeny Dish under the creative leadership of John Kirkpatrick and Sue
Harris. These dances combined the sheepskin hey idea with the Leominster
figures. Several border morris sides have since adopted this idea in
various forms.
So, in summary, we have no information regarding the content and form of
the dances prior to the mid 19th century; we know that 3JS was assimilated
into border morris in the 1970s; the assumption that the sheepskin hey must
have been part of morris before that is a wild guess, no better than
assuming "knees up muvvah brahn" was part of morris.
If you've communicated with Roy Dommett, you already have all the
verifiable evidence that has yet been uncovered. If you ask the people on
this list, you may soon find yourself to be no longer in Kansas.
My opinions are also those of my employer.
Nick Robertshaw
_________
Subject: Re: (NMC) Rise Up Singing,vol.2 - qualified defense
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 23 Jul 1997 17:00:01 -0400
Content-Type: text/plain
You should know that my anti RUS post received 4 off-list replies of
agreement and none of contention (although Rebecca Jordan pointed out that
it has its uses). There seems to be something about it that ups peoples
backs. Perhaps people don't like to be reminded of the Great Folksong Scare
(when it nearly caught on); perhaps it seems rather Christian biased (there
are many here proud to be unsaved).
Well, anyway, the question was asked on one of those days when I was better
supplied with bile than blood. And I have to admit to owning a copy and
referring to it on several occasions. Tell them to lose the cheesy drawings
and put some melodies in next time. Point them to the Digital Tradition for
material, then Child, Baring-Gould, and the C# lib. Keeping the
contemporary pablum out will help the copywrite problem too.
Glenda's advice:
> Smile sweetly, nod vigorously and sympathetically to their snivelling
> complaints...
would be quite out of character for me.
My opinions are also the opinions of my employer. So there!
Nick Robertshaw
________
Subject: Re: working class morris
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Tue, 22 Jul 1997 09:17:59 -0400
Content-Type: text/plain
>Well, Ken Smith of Seattle (who knows me personally, and vica versa) is
>giving me a real run for my money in this thread, but I am getting very
>nervous that nobody else is chiming in with their two cents. Are you
>watching with bemused interest from the side, or di you thrown up your hands
>long ago, and hit the delete key whenever you see our names?
>
No, really Norman. We've all been reading every word. Riveting stuff
Keep it up.
Nick.
Nick Robertshaw
________
Subject: Re: (NMC) Rise Up Singing,vol.2; suggestions (fwd)
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Mon, 21 Jul 1997 09:43:08 -0400
Content-Type: text/plain
If you have a song for Rise Up Singing Volume 2, I would suggest that you:
Sing it to your children
Sing it in pubs
Sing it at ales
Never sing it twice the same way
but don't send it to RUS, the Holy Scripture of Folk Songs. I'm sure they
mean well, but the result is little claques that huddle around perceived
'correct' versions of songs, complaining about 'the wrong words', sniping
at verse order 'errors' and disembowelling music of all joy and
sponteneity.
These putrid little toads should have their fetid eyeballs gou...
oops. I was ranting without clogs again wasn't I.
Well, you get the idea.
Nick Robertshaw
________
Subject: Bar Strangled Spanner (NMC, but you're the people to ask)
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Sun, 13 Jul 1997 10:45:28 -0400
Content-Type: text/plain
The tune for the ballpark song that begins "Jose, can you see.." is reputed
to be an old drinking song. I have the fragment:
Give a cheer, give a cheer,
For the men who drink the beer
In the cellar of Weller's Saloon.
They are brave, they are bold,
For the liquor they can hold
In the cellar of Weller's Saloon.
This doesn't scan correctly and seems a bit short. Can anyone supply the
full version?
Nick Robertshaw
________
Subject: Please, not a usenet group
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Sun, 6 Jul 1997 19:17:50 -0400
Content-Type: text/plain
>I know this gets raised on a regular basis but what would be the drawback
>of a newsgroup.
There are several drawbacks. The Squeezebox community changed from mail
list to newsgroup over a year ago (because the traffic was getting too much
for some people and following some consideration of alternatives, such as
splitting the list). I observed the following changes as a result:
1. The community was no longer 'there' for people to address. In the mail
environment, nearly all subscribers read or scan most submissions every
day; in the news environment, people go browse the group if the mood takes
them. So the newsgroup is no longer a useful means for broadcasting a "Hey
everyone, how about..." type of message.
2. More SPAM, unsolicited commercial rubbish, and irrelevant cross-posts
(MAKEMONEYFAST, SendPostcardToDyingBoy, ModemTax, GoodTimesEmailVirus,
didum, didum, didum).
3. Loss of people who cannot get news or all newsgroups (they had to set up
a digest-mail version to cover this)
Dave Barnert, do you concur?
If we went to News, we would probably lose the DOOMD (since there would be
no subscription list to seed the database), a valuable resource.
I believe that the MDDL, for all its flaws, is a useful means of connecting
our morris diaspora that would not work as well if it was a newsgroup.
Nick Robertshaw
________
Subject: Towns and Villages
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Thu, 19 Jun 1997 09:25:10 -0400
Content-Type: text/plain
If it has a market, it can't be a village. It has to be a town or a city.
If it has churches, pubs, forges and a constabulary, it might still be a village
If it has a cathedral, it's a city.
If it has no church, it's a hamlet
If it's holding a skull, it may be a Hamlet
New York and Chicago have markets. These are therefore not villages. If
Greenwich Village has a market, it has a problem.
In the South Midlands and elsewhere in England, it's pretty easy to tell if
a place had a market because the main street is wide enough to accommodate
it. Brackley and Chipping Campden are market towns. Longborough and
Ascot-under-Wychwood are villages.
Nick Robertshaw
________
Subject: Re: the Naming Thing
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 18 Jun 1997 12:51:25 -0400
Content-Type: text/plain
>Following bits of William L. Brown and Dr. Tony Barrand
>
>
>And tell me, as far as
>your exiled foremen are concerned, when they go home do their mothers tell
>them (as does mine) that they *sound* American. I guarantee their movement
>acquires the accent too. They definitely bring you an English "influence".
>I never suggested otherwise. But the current PLACE is more powereful an
>influence than the former one. A good dancer expresses the here and now,
>not the there and then.
>
>>Would you say the same about other ethnic dancing/customs performed in the
>>US? Is a Greek folk-dance performed in Cleveland now an American folk-dance
>>because of where it is danced?
>
>yes, and I'll bet you Greek-Greeks can spot someone who learned their
>"Greek" dancing in America.
>
QED. What we now speak is American. However it is still widely referred to
as English. We need to put a stop to this before we end up with a dance
called The Longborough Stick originating from Chipping Campden. Imagine how
confused people would be.
Nick Robertshaw
________
Subject: Photo of Stick and Bucket Dance
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Mon, 16 Jun 1997 08:37:21 -0400
Content-Type: text/plain
A photo of the Stick and Bucket Dance (performed by Lancre MM) can be found at:
http://isg.cs.tcd.ie/cbuckley/clarecraft/Event95/stick_bucket.html
Even more interesting is Mrs Widgery herself, finding morris dancing most
uplifting at:
http://isg.cs.tcd.ie/cbuckley/clarecraft/Event95/morris_finale.html
Note: DO NOT visit this site if you are a serious Pratchett fan and you
have stuff to do in real life. It is a serious time waster!
Nick Robertshaw
________
Subject: Caper Hang Time, SF solution
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Mon, 16 Jun 1997 08:19:07 -0400
Content-Type: text/plain
Douglas Adams has the solution:
The secret for extending jig capers is the same as the secret of flight.
You simply have to miss the ground. Dancers whose capers are only lasting a
second or so are just failing to miss the ground. In order to miss
something so obvious (the ground is rather large around here), you must be
presented with a significant distraction when at the apogee of the caper.
It is the responsibility of bystanders to create such distractions. Sudden
shouts of 'free beer' or exposure of attractive expanses of skin are most
likely to produce a flying dancer.
Experiment with these ideas next time you are watching a jig.
Nick Robertshaw
________
Subject: Re: Morris Words Archive
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Sun, 15 Jun 1997 13:53:15 -0400
Content-Type: text/plain
>Carol (CEN95001) wrote:
>>> I was interested in the possibility that MDDL might have a "Morris Words
>Archive."
Well someone has an excellent collection of morris songs that they mailed
me a few months ago (just a colletion of files, not a database like the
DT). And I was delighted to receive it since it contained the words of a
song that *I* had written and subsequently lost.
Rich Holmes? Peter Hoover? Own up now!
I'd put them up on a server myself except that I am not in need of another
project at this time.
Nick Robertshaw
________
Subject: Oh and by the way..
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Fri, 13 Jun 1997 17:26:37 -0400
Content-Type: text/plain
>I think I've
>got it, and I know it's silly, but what was the name of the
>Upton-on-Severn Stick Dance?
>
William Griffen often danced the real Upton-on-Severn Stick Dance with a
fish in his hat (outside, as a decoration; not inside; as a pet). Is that
why you called it silly, Tony?
;->
Nick Robertshaw
________
Subject: Re: The naming thing
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Fri, 13 Jun 1997 16:40:25 -0400
Content-Type: text/plain
>I think I've
>got it, and I know it's silly, but what was the name of the
>Upton-on-Severn Stick Dance?
>
Were I to be cajoled into a real discussion about dance names (and I find
performing them much more interesting than talking about them), I would
venture that there are few sucessful dance names, by which I mean few from
which our casual audiences can glean anything useful. With the briefest of
explanations, names such as Bean Setting or Swaggering Boney can help the
observer find something understandable in the dance. But for the majority
of non-programmatic dances, however, the name serves little function other
than to identify the dance to the dancers themselves (i.e. 'that's its
name'). Laboring the audience with minute details of a dance's provenance
can cause them, or at least their attention, to drift away. Of course, side
discussions with dance cognescenti call for complete disclosure of the
details as known. This toss needs only be given to those who give one.
Representing our dance as The Binghamton Stick dance (and it is no longer
identical to the dance that Binghamton or Newtowne perform) is slightly
useful because it gives the audience another point of reference that they
might be familiar with (more likely than the name of a Cotswold village or
an 18th century tune). This gives them another small reason to pay
attention. I can imagine them saying "Watch this one, Mildred. It's a real
American dance", and then engaging in some comparison. It seems to be an
important part of the showmanship to imply that the dance is exotic, even
if only from upstate New York, and we couldn't achieve this by calling it
the Foggy Bottom Stick Dance.
So, let us balance this fart on this razorblade a moment longer to consider
the dreaded Upstick on 8 dance. Unfortunately, if it ever had a name, Maud
forgot to ask for it or her informer, William Griffen, was unable to recall
it. The Geoff Hughes/Albion/Chingford version draws from and expands upon
the collected version (without violating it, IMSHO) to create a dance that
served well in its role as cabaret morris for a touring rock band. All our
guys love to dance it and it has been in the FBMM rep for many years. All
that time we have called it The Upton-on-Severn Stick dance. This has not
been laziness, ignorance, or audacity. The dancers learn along the way that
it came to us via the North Circular Road of suburban London but by then
it's too late, the dance has a name, so that's what we use simply because
of the insuperable inertia that must be overcome to change it. Other sides
do dances by the same name with varying degrees of difference in the dance.
This situation has abundant traditional precedence.
But, if Geoff ever reaches a level of fame outside our tiny parish of
folkies (it could happen in a clog version of Riverdance), then we will
find it easier to rename it the "Geoff Hughes Cafeteria Table Stick Dance,"
which is at least more interesting than "Dance X".
But I would never let myself be drawn into such a discussion.
One of our team members is Jim Lewis, but I don't expect our barkers to
explaing to the audience that he's not the same guy as the Jim Lewis that
put the Cyanide in the Tylenol. It's just his name, OK?
Nick Robertshaw
________
Subject: *** Whack *** folly rolly rolly (NMC)
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Mon, 9 Jun 1997 11:19:02 -0400
Content-Type: text/plain
Dungeon basements, Gothic lighting
Piercing, cutting, searing, biting
These are things that we delight in
While we are in leather
(I'm not getting into this, really)
________
Subject: Re: adopted dances
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Mon, 9 Jun 1997 08:57:01 -0400
Content-Type: text/plain
Foggy Bottom calls the Binghampton Stick Dance the Binghampton Stick Dance
not because Peter Klosky or John Dexter gives us permission; not in spite
of Dr Barrand's ex cathedra pronouncements; even though other teams do a
similar or different dance by the same name traceable to the same origin;
even if someone ascribes its authorship to Chipping Campden; merely
because...
That's its name.
Many thanks to John and the Bouwerie Boys for a most excellent Ceudeaughs.
The ale was visited by a demonic spirit in the form of a White Rat,
perverting the chorus of "Let Union Be.." during the intercourse singing at
the feast:
Let bondage be in all our arts
Let both our wrists be joined as on
We'll end the day as we begun
End it all in leather
*** Whack *** folly rolly rolly rolly, too ra lido
^^^^^ << flagellate here
etc.
Verse contributions can be submitted here (under an appropriate subject
line). This to roll the ball:
Soon the lady with the whip'll
Show you how the metal clip'll
Fix the chain onto your nipple
While we're all in leather
Nick Robertshaw
_________
Subject: Re: Antisocial ale attendees
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Thu, 5 Jun 1997 14:21:59 -0400
Content-Type: text/plain
Elaine,
>I think the hardest part of planning the Halloween ale was dealing with
>entertaining folks on the Saturday evening. Do we let them loose in
>Fells Point with all the local weirdos to celebrate the season? Do we
>try to organize a meal and dancing?
As I recall, the swimming and hot-tub at the naturist resort worked quite
well at luring the hardened (ahem) drinkers away from Fells Point and
sending them towards the evening festivities.
Sic Transit Gloria Mundi (how is Gloria doing these days?)
Nick Robertshaw
_________
Subject: Re: Mr. Martin's Miseries
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Tue, 20 May 1997 23:26:42 -0400
Content-Type: text/plain
I have now emailed him twice with detailed instructions for unsubscribing.
It seems he's a bit of a thicky.
>Can someone put this poor bastard out of his misery, or provide him with
>instructions as to quickening his own demise? Is there a virtual Dr.
>Kevorkian out there? I can't stand to listen to a living creature suffer so,
>and it does tend to fill up my mailbox.
>
>Peter Klosky
>BinghamtonMM/BFHarridans
Nick Robertshaw
________
Subject: Studmuffins and Muffinettes (corrected URL)
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Mon, 12 May 1997 18:55:43 -0400
Content-Type: text/plain
An offering for the Studmuffins of Morris calendar can be viewed at
<http://www.paraglyph.com/pgweb/studm.html>
This is a 96k jpg. Avoid if you are bandwidth-impaired or offended by
nudity, mixed morris, or jokes that begin "A Rabbi, a Priest and a stripper
were on an ice-fishing trip..."
Thanks to those members of the various mid-atlantic morris teams that
modelled for the picture. I hope you managed to get all the paint off.
Nick Robertshaw
________
Subject: Studmuffins and Muffinettes
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Mon, 12 May 1997 18:52:36 -0400
Content-Type: text/plain
An offering for the Studmuffins of Morris calendar can be viewed at
<http://www.paraglyph.com/pgweb/stdm.html>
This is a 96k jpg. Avoid if you are bandwidth-impaired or offended by
nudity, mixed morris, or jokes that begin "A Rabbi, a Priest and a stripper
were on an ice-fishing trip..."
Thanks to those members of the various mid-atlantic morris teams that
modelled for the picture. I hope you managed to get all the paint off.
Nick Robertshaw
________
Subject: Re: "Lass..." in "The Go-Between"?
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 16 Apr 1997 00:27:52 -0400
Content-Type: text/plain
This is a bit like discovering that Paul McCartney was in another band
before Wings.
The Lass of Richmond Hill was a popular song using a poem by Leonard
Macnally set to music by James Hook.
About 100 years later (1970-ish) Hammersmith invented a Longborough dance
to the tune, because it obviously needed one.
Strangely, the words are not in the Digital Tradition so...
On Richmond Hill there lives a lass
More bright than May-day morn
Whose charms all other maids surpass
A rose without a thorn
This maid so neat with smile so sweet
Has earned my right goodwill
I'd crowns resign to call her mine
Sweet lass of Richmond Hill
Ye zephyrs gay that fan the air (reference to camp '60s Fords?)
And wanton thro' the grove
O whisper to my charming fair
"I die for her I love"
This maid, etc.
I'm sure that Ian Wallace has sung it at the end of My Music.
>Just watched the 1970 film "The Go-Between" the other night, and came
>upon what might be a vague morris reference, i.e., "Lass of Richmond Hill."
>In one scene, we see a boy sneak out of his room, down the stairs and go
>outside. In the background there is a faint sound of a woman (supposedly Julie
>Christie?) singing with a piano accompaniment, and the tune sounds very much
>like that of "Lass" (the one used for the Longborough-Fieldtown version).
>Trouble is, I can't for the life of me make out what she's singing, so I don't
>know if it's actually "Lass" or another song making use of the melody.
>I suppose I can run it back and forth a few times, and put my ear close to the
>speaker, but does anyone here know?
>
>Sean Smith
Nick Robertshaw
________
Subject: Re: The Abbots Bromley Horn Dance web site
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Tue, 15 Apr 1997 11:52:33 -0400
Content-Type: text/plain
>Well done Andrew,
>
>I can see nothing wrong with the transcriptions Nick Robertshaw =
>complains about although I can see you would need a monitor with good =
>resolution to read it or perhaps a pair of glasses. The minims are =
>visible and distinguishable from the crochets.
>=20
>Paul Draper =20
>
>pdraper@baig.co.uk
>
Thanks Paul! I revisited the site, captured the gif and enlarged it in
Photoshop.
Your conclusion is basicly correct, I need new glasses. It might also have
helped if my monitor resolution had been set lower.
Now I've embarrased myself in front of the entire online morris community.
Fortunately, after nearly 30 years of morris dancing I have become
completely insensitive to large-scale public embarrassment.
Nick Robertshaw
________
Subject: Re: The Abbots Bromley Horn Dance web site
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Tue, 15 Apr 1997 08:46:53 -0400
Content-Type: text/plain
>Call me obsessional...
>
>I have just finished version 1.0 of the Abbots Bromley Horn Dance web
>site. Its URL is http://www.nsn.org/ABHD. Please have a look, and let me
>know what you think.
>
Hey, Obsessional!
Is the Edie Sammon's tune transcribed correctly? Your version shows
two 4/4 bars among the 3/4 bars which would seem to make it very
strange to dance to. Your time sig is 4/4 but the first 4/4 bar
doesnt show up until measure 6. The .gif show 26 crotchets which
would make the tune a bit gimpy in either 3/4 or 4/4, especially
when mixed with 'Yankee Doodle" (which has quarter notes of course,
not crotchets).
Thus new traditions are documented.
Perhaps you could go over Mr. Guy Maclean-Eltham's work more carefully.
Perhaps the problem is that there are minims that are indistinguishable
from the crotchets.
The William Adey tune seems to have suffered the same fate.
Nick Robertshaw
________
Subject: Purfeckshun
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Thu, 10 Apr 1997 10:44:01 -0400
Content-Type: text/plain
I would question the authenticity or desirability of perfection in the
context of Morris. Perfection would seem to imply a uniformity among the
dancers that while perhaps desirable at the Bolshoi does not seem to have
present among the Old Dead Guys. Should we presume to dance 'better' than
they did?
Technology will soon be capable of projecting five holographic duplicates
of a team's 'best' dancer, appearing as a 'perfect' set in perfect unison.
The technology might be interesting, but certainly not the dancing; 6 x 1 =
1 in this example. The charm and quaintness of these dances is not
threatened by a little occasional wrong-footedness or dropped-stickedness
(that's my excuse and I'm sticking to it).
I did once observe a perfect side, but they were just all perfect assholes.
Nick Robertshaw
________
ubject: Re: Aids to dancing
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Fri, 21 Mar 1997 08:18:03 -0500
Content-Type: text/plain
>
>My favourite manner of consumption, introduced to
>me by a famous Adelaide Morris Man, Michael Bowe, was to pace 8 aspirin in
>a chocolate milk shake, allow 2 minutes for the aspirin to dissolve and
>then consume. Of course this medication was consumed during a long day of
>dancing and drinking.
>
>I have always wondered whether the chocolate milk shake enhanced the effect
>of the drugs or had no effect. In any event it allowed me to indulge
>another of my favourite past times.
>
Vomiting?
Nick Robertshaw
________
Subject: Re: pharmaceutical question...
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 19 Mar 1997 21:55:12 -0500
Content-Type: text/plain
>Tylenol is a brand name. You might look under the generic name, which
>is "acetominophen".
>
>Jeff Bigler
Except in the UK its generic name is paracetamol and its brand name is Panadol.
Nick Robertshaw
________
Subject: Re: Perverted Parodies on Parade
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Mon, 10 Mar 1997 13:59:23 -0500
Content-Type: text/plain
>[delurking for a moment] As a proud member of White Rat's Morris, I
>would like to say that, as far as I'm concerned, Bill Brown, Nick
>Robertshaw, and Ken Anderson are welcome to come join us anytime they
>are anywhere near San Francisco. Are you free in late June guys? We
>could always use extra dancers for the Gay/Lesbian/Bisexual/Transgender
>Pride Celebration. Contrary to popular belief, we don't require that
>you be a sexual pervert/street dyke/mildly neopagan/motorcycle gang
>type. Your posts show enough of the appropriate 'rattitude', at least
>for me and I think other Rats would agree.
>
>As far as whether or not what we do is a parody, perhaps that could be
>determined once everyone (or, at least, a majority) agree upon a
>definition of Morris (or is that morris?).
>
Well, as long as you don't mind a POHM (plain old hetero male) I'd be glad
to dance or play. I must however draw the line at screwing my concertina to
my hands since it's a valuable antique.
Nick Robertshaw
________
Subject: Re: farmer's market . . . sex party?
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Sat, 8 Mar 1997 23:17:49 -0500
Content-Type: text/plain
>>Bill Brown writes
>>OK, you're in San Francisco, you're a morris dancer, and you have a
>>choice--dance at a farmer's market . . . or a sex party?
>
>>farmer's market . . . sex party? farmer's market . . . sex party?
>
>>The Choice Seems Clear To ME!
>
>
You mean your farmers' market doesn't have a sex party?
Nick Robertshaw
________
Subject: Re: Morris Tune :)
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 5 Mar 1997 16:39:21 -0500
Content-Type: text/plain
>I've just heard a set of Morris tunes on the classical radio station.
>
>One of them goes like this:
>
>du du du du dum dum dum du du du
>
>Can anyone identify, please?
>
Old Molly Oxford, without a doubt.
Nick Robertshaw
________
Subject: Will the real Morris please Identify itself
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 5 Mar 1997 08:45:04 -0500
Content-Type: text/plain
Given (by Roy Dommett [or is that Roy Dolmeltsch] and others on this list)
that 98% of the recorded, collected, and performed material is..
concocted
corrupted
degenerate
self-indulgent
indulgent of the cute blond(e)..
which is the 2% that is un.. all of the above?
There. That should be more fun than a pinata full of cottonmouths.
btw, re: MMDL drivel-to-useful-content ratio, that senseless drivel is not
noise, it's carrier. It can be disregarded just as the 102.5 MHz carrier
can be. Adjust your receivers and all you will hear is the beautiful
modulation.
Nick Robertshaw
________
Subject: Re: Star of the County Down
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 19 Feb 1997 09:46:40 -0400
Content-Type: text/plain
SotCD is nearly as ubiquitous as Princess Royal. Indeed, those who claim
that there are only 2 tunes will tell you that SotCD is the 'other' one.
In its SotCD incarnation it is probably a 19th century or Edwardian art
song (it smacks of A.P. Graves or Thomas Moore to me but elseone will
doubtless enlighten us)
It has been well used in:
Dives and Lazarus (Vaughan Williams offers five for the price of one),
Banks of Newfoundland,
Van Dieman's Land
Podger Fills his Wellies, and
The Unquiet Grave.
The tune was written by William Morris and is never played with a bass drum.
Nick Robertshaw
________
Subject: Instructions for Unsubscribing
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Mon, 3 Feb 1997 09:14:20 -0400
Content-Type: text/plain
>Can some kind soul send me a private email about unsubscribing ? Accidentally
>I erased all the neccesary info. Many Thanks !
>Dorisruth@msn.com
>
>
>First, ask your Internet Provider to mail you an Unsubscribing Kit.
>Then follow these directions.
>
>The kit will most likely be the standard no-fault type. Depending
>on requirements, System A and/or System B can be used. When
>operating System A, depress lever and a plastic dalkron unsubscriber
>will be dispensed through the slot immediately underneath. When you
>have fastened the adhesive lip, attach connection marked by the
>large "X" outlet hose. Twist the silver- coloured ring one inch
>below the connection point until you feel it lock.
>
>The kit is now ready for use. The Cin-Eliminator is activated by
>the small switch on the lip. When securing, twist the ring back to
>its initial condition, so that the two orange lines meet.
>Disconnect. Place the dalkron unsubscriber in the vacuum receptacle
>to the rear. Activate by pressing the blue button.
>
>The controls for System B are located on the opposite side. The red
>release switch places the Cin-Eliminator into position; it can be
>adjusted manually up or down by pressing the blue manual release
>button. The opening is self- adjusting. To secure after use, press
>the green button, which simultaneously activates the evaporator and
>returns the Cin-Eliminator to its storage position.
>
>You may log off if the green exit light is on over the evaporator .
>If the red light is illuminated, one of the Cin-Eliminator
>requirements has not been properly implemented. Press the "List
>Guy" call button on the right of the evaporator . He will secure
>all facilities from his control panel.
>
>To use the Auto-Unsub, first undress and place all your clothes in
>the clothes rack. Put on the velcro slippers located in the cabinet
>immediately below. Enter the shower, taking the entire kit with
>you. On the control panel to your upper right upon entering you
>will see a "Shower seal" button. Press to activate. A green light
>will then be illuminated immediately below. On the intensity knob,
>select the desired setting. Now depress the Auto-Unsub activation
>lever. Bathe normally.
>
>The Auto-Unsub will automatically go off after three minutes unless
>you activate the "Manual off" override switch by flipping it up.
>When you are ready to leave, press the blue "Shower seal" release
>button. The door will open and you may leave. Please remove the
>velcro slippers and place them in their container.
>
>If you prefer the ultrasonic log-off mode, press the indicated blue
>button. When the twin panels open, pull forward by rings A & B.
>The knob to the left, just below the blue light, has three settings,
>low, medium or high. For normal use, the medium setting is
>suggested.
>
>After these settings have been made, you can activate the device by
>switching to the "ON" position the clearly marked red switch. If
>during the unsubscribing operation, you wish to change the settings,
>place the "manual off" override switch in the "OFF" position. You
>may now make the change and repeat the cycle. When the green exit
>light goes on, you may log off and have lunch. Please close the
>door behind you.
>
>********************************************************************
>Anyone w/out a Sense of Humor Is At The Mercy of The Rest of Us. :-)
>********************************************************************
Oh, you asked for a kind soul to send you instructions...
never mind.
Nick Robertshaw
________
Subject: Re: Morris Musos in Top Bands
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Fri, 31 Jan 1997 09:58:54 -0400
Content-Type: text/plain
>On Fri, 31 Jan 1997, David Rogers wrote:
>
>> I can think of three ex-morris musicians who have gone on to play in
>> well-known folk or folk/rock bands:
>>
Andy Cutting of Blowzabella is son of Herga Morris dance John Cutting.
Jennifer Cutting (no relation) of New St. George was muso for Rock Creek.
And if Alice Cooper didn't play for the White Rats, then he should have.
Nick Robertshaw
________
Subject: Re: Traveler's Warning (limited morris content)
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Tue, 28 Jan 1997 09:21:44 -0400
Content-Type: text/plain
>From: "William L. Brown"
>Subject: Traveler's Warning (limited morris content)
>Date: 24 January 1997 13:27
>
>. . . A person in the bar walks up as they sit alone and offers to
> buy them a drink. The last thing the traveler remembers until they
> wake up in a hotel room bath tub, their body submerged to their neck
> in ice, is sipping that drink. There is a note taped to the wall
> instructing them not to move and to call 911. . . both of the
> business traveler's kidneys have been harvested.
>----------------------------------------------------------------------
Bill, if you are going to be a journalist, you must learn to check your FAQs.
This urban legend dates back to the early days of organ transplantation,
when it was a new and scary technology.
Couple of other interesting points:
The cities named -- New Orleans and Las Vegas -- both have reputations
for, ah, moral decay. Like many folktales, this one has a cautionary
message: "Don't go to sinful places and accept drinks from strangers."
Organ theft has been a theme in science fiction, though much more so a
few decades ago than now. Larry Niven was one of the more notable
authors who used it.
In some ways, this is an updating of the classic vampire story.
Come to think of it, I believe when blood transfusions were as new as
organ transplants were 20 years ago, there were similar stories about
rich people keeping "farms" of kidnapped young girls to be drained of
their blood to keep the rich guys young. Echoes of Elizabeth Bathory?
There have also been TV cop shows (Law and Order?) based on this UL.
Who would choose a morrisman's kidney anyway? Wear your
FYBs at all time and you'll be safe.
Nick Robertshaw
________
Subject: Re: Skipping
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Thu, 23 Jan 1997 09:07:18 -0400
Content-Type: text/plain
> Singles:
> h |s h s h |s h s h |
>
> Skipping:
> h|s hs h|s hs h|
>
>John Carver
>Island Thyme
>(the Not-For-Joes are fixing their fonts)
No fair, you cheated and changed the time signature. Unless you mean to
imply that single-step = 4/4 and skipping = 6/8
Be warned, this would make Brackley "Jockey to the Fair" a skipping dance.
Nick Robertshaw
________
Subject: Re: Captain Pugwash ..... and beyond
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Sun, 22 Dec 1996 09:30:52 -0400
Content-Type: text/plain
>
>Captain Pugwash and Dr,Who have had a good airing in the list, and some
>subscribers may think this is too much. Hear, hear! What about the Wooden Tops,
>Andy Pandy, Rag, Tag and Bobtail, Muffin the Mule, Fireball XL5, Joe 90,
>Captain
>Scarlet, Thunderbirds, Space Patrol, Emergency Ward Ten, Z Cars, Whirlybirds,
>Highway Patrol, No Hiding Place, Rawhide, Maverick, Branded, Laramie and
>Quatermass? We have much still to discuss.
>
Another great thing about this list: Paul can enjoy Muffin the Mule
and none of us has to watch.
I only hope it is a consenting adult mule.
.
--* Always lick your fingers clean *--
--* Before you shake the hand of the Queen *--
-----
Nick Robertshaw | (301) 694 8604 (w) / ..... \
Frederick MD, | (301) 694 8820 (h) / ::::: \
ParaGlyph | \ ..... /
Foggy Bottom Morris Men (4m'n) \ ===== /
Capering Jeffries Duet player -----
________
Subject: Re: Is mummering pagan?
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 4 Dec 1996 09:21:06 -0400
Content-Type: text/plain
Mumming is obviously anti-christian, a mocking skit on the death and
resurrection of the hero/savior. The Go(o)d Doctor lambastes the idea of
God ("Italy, Spitaly" neatly spearing the Genesis creation myth). Father
Christmas represents the Nicolas Parsons/Bob Saggett/Pope persona. Little
Johnny Jack must be, er, St. Paul.
It was almost certainly written by a Hindu/Islamic/Pagan/Secular
Humanist/Animist coalition.
Next question?
-----
Nick Robertshaw | (301) 840 8604 (w) / ..... \
Frederick MD, | (301) 694 8820 (h) / ::::: \
ParaGlyph, See What we can Imagine \ ..... /
FBMM, 4m'n \ ===== /
Capering Jeffries Duetist -----
________
Subject: Re: GENERATION GAP
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Thu, 14 Nov 1996 10:33:11 -0400
Content-Type: text/plain
> re: famous tv personalities:
> ok, i'll bite. remember, i'm just an innocent american. whatEVER
> is the generation game? sharon "trivial pursuit" mckinley, and
> not an official trivia expert for any government agency
BBC Saturday Prime time TV family game show. Guests demonstrate some craft
or skill and contestants try their hand at it. Guests award contestants
points. Guests skills increase in complexity as show progresses. Some are
artisan skills, such as plastering, cake decorating, etc. Royal School of
Ballet boys morris did a guest spot in 197?; We (Herga Morris) wrote and
complained that they should hire a *proper* morris team for this gig next
time. So next time they hired us! I am amazed to learn that the show is
still running (and hiring morris teams!).
-----
Nick Robertshaw | (301) 840 8604 (w) / ..... \
Frederick MD, | (301) 694 8820 (h) / ::::: \
ParaGlyph, See What we can Imagine \ ..... /
FBMM, 4m'n \ ===== /
Capering Jeffries Duetist -----
________
Subject: Re: Black Blacks Facts
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Thu, 19 Sep 1996 17:19:42 -0400
Content-Type: text/plain
..for those academics and picayunes that like broad assertions decorated
with claimed historical fact...
James Bland (1854-1911) was a Lawyer (trained at Howard University) and
minstrel and a black man. He wrote many songs in the idiom, including "Oh
Dem Golden Slippers" and "Carry me Back to Old Virginny" (the state song of
Virginia). He performed with black minstrel troupes Billy Kersans',
Sprague's Georgia Minstrels, and Callendar's Coloured Minstrels. They were
required to black their faces. In 1881 he left the US to tour Europe, where
the burnt cork was not required or used.
The George Mitchell Minstrels of the revival Black and White Minstrel Show
used grease paint.
Note tha the names of the troupes seemed to have avoided the term 'nigger'
(perhaps it was viewed as indelicate even then). Other act names:
The Ethiopean Serenaders
The Royal Aborigine Minstrels
Harry Templeton's Original African Opera Troupe
Andy Merrilee's Armour Clad Amazon Female Christys
(I am not making this up!)
That last one would work for a womens Northwest team.
-----
Nick Robertshaw | (301) 840 8604 (w) / ..... \
Frederick MD, | (301) 694 8820 (h) / ::::: \
ParaGlyph, See What we can Imagine \ ..... /
FBMM, 4m'n \ ===== /
Capering Jeffries Duetist -----
_______
Subject: Black Black
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Thu, 19 Sep 1996 09:41:14 -0400
Content-Type: text/plain
>Talking of cows.
...scatalogical anecdote clipped
> The farmer just smiled
>wryly as he ambled by.
>
Sounds like you were full of shit that day, Paul.
>
>Talking about blacking up, what about black dancers? My view is that that as a
>mask, it does not matter what colour you are underneath, its still a mask, and
>no-one is as black as Grimas black water-based makeup, which makes a
>difference,
>no matter what hue you are. Personally I feel the existance of Morris is
>essential to remind us black folk that you white folk have got no sense of
>rhythm.
>
Historical precedence. One of the best beloved performers from the "nigger
minstrel" period (a correct term, if not politically so) was indeed a black
man. He was required to black up for each performance. Indeed, he had to
put on the exagerated 'golliwog' makeup of the minstrelsy. Let the
sociologists take their discussion of the significance of this elsewhere.
-----
Nick Robertshaw | (301) 840 8604 (w) / ..... \
Frederick MD, | (301) 694 8820 (h) / ::::: \
ParaGlyph, See What we can Imagine \ ..... /
FBMM, 4m'n \ ===== /
Capering Jeffries Duetist
________
Subject: Poynton Jemmers
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 18 Sep 1996 10:14:23 -0400
Content-Type: text/plain
Can anyone supply me with a contact for the Poynton Jemmers Northwest
Women's Morris (assuming they still exist). Or for Annie Mettan who was
part of the team some 18 years ago??
-----
Nick Robertshaw | (301) 840 8604 (w) / ..... \
Frederick MD, | (301) 694 8820 (h) / ::::: \
ParaGlyph, See What we can Imagine \ ..... /
FBMM, 4m'n \ ===== /
Capering Jeffries Duetist -----
________
Subject: Foggy Bottom Picture in Online Magazine
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 11 Sep 1996 19:27:40 -0400
Content-Type: text/plain
Washington DC's Glossy society magazine and pickup rag, THE WASHINGTONIAN,
carries a picture of Washington DC's Glossy pickup team, THE FOGGY BOTTOM
MORRIS MEN.
And since The Washingtonion is a hi-tech up-to-the-minute state-of-the-art
publication, the picture is in their online version and can be admired by
one and all at
http://www.washingtonian.com/thismonth/out&about.html
(scrool down to the picture at the front of the National Cathedral)
-----
Nick Robertshaw | (301) 840 8604 (w) / ..... \
Frederick MD, | (301) 694 8820 (h) / ::::: \
ParaGlyph, See What we can Imagine \ ..... /
FBMM, 4m'n \ ===== /
Capering Jeffries Duetist -----
________
Subject: Re: New Side to the Police
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Fri, 23 Aug 1996 15:24:48 -0400
Content-Type: text/plain
>>"Three policemen from the force's headquarters in Maidstone are hoping
>>to set up their own Morris Dancing troop.
>
>I'd love to see a dance with batons instead of sticks. ;)
That would be 'Lads A'Truncheon', I believe.
-----
Nick Robertshaw | (301) 840 8604 (w) / ..... \
Frederick MD, | (301) 694 8820 (h) / ::::: \
ParaGlyph, See What we can Imagine \ ..... /
FBMM, 4m'n \ ===== /
Capering Jeffries Duetist -----
________
Subject: Re: Recordings of older generation traditional morris fiddlers.
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 14 Aug 1996 09:45:20 -0400
Content-Type: text/plain
>
>I have only heard Arnold Woodley, William Kimber and Stephen Baldwin play
>(the first, live; the others, recordings). However, as a general comment
>(which applies equally to country dance and morris tunes), and with due
>respect to our now-departed inspirers, I find the standard of playing rather
>wanting. (This is being polite!) It seems to me that the modern players
>(John Kirkpatrick et al) are FAR more skillful and enjoyable to listen to.
>Is this commiting some sort of sacrilege?
>----------------------------------------------------------------------
Not at all. Kimber, fine though he might have been, was very strict with
himself about the 'right way' to play the concertina that left a huge part
of the instrument's capability unexplored and unused. John K. and
contemporaries found and extended the polyphonic Anglo way beyond that (for
example, using a more fiddle-like articulation to 'yump' the downbeats;
using a harmonic vocabulary beyond I-IV-V). This makes the music much more
interesting to listen to and lifts the dancers by a huge amount. I danced
with the Smiffs when John was still with them and I can attest to the
astonishing boost that his playing could give to a tired team at the end of
a tour.
So, lead that beat!
play those spice chords!
-----
Nick Robertshaw | (301) 840 8604 (w) / ..... \
Frederick MD, | (301) 694 8820 (h) / ::::: \
ParaGlyph, Beyond what is carved in stone \ ..... /
FBMM, 4m'n \ ===== /
Capering Jeffries Duetist -----
________
Subject: Re: Country Kissing
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Thu, 18 Jul 1996 10:39:40 -0400
Content-Type: text/plain
(Isn't country kissing when you do it with your cousin?)
>
>There is kissing *specified* in Kettle Drum, an Elizabethan-era country
>dance consisting of a 4-couple square. Men & Women kiss *both* their
>partner and their closest neighbor.
Is this a one-beat peck?
A one-measure buss?
An eight-measure snog?
Or a full 32-measures of breath-sucking tonsil hockey?
just wondering.
-----
Nick Robertshaw | (301) 840 8604 (w) / ..... \
Frederick MD, | (301) 694 8820 (h) / ::::: \
ParaGlyph, Beyond what is carved in stone \ ..... /
FBMM, 4m'n \ ===== /
Capering Jeffries Duetist -----
________
Subject: Re: Border bands
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Sat, 29 Jun 1996 23:02:38 -0400
Content-Type: text/plain
>It's true. That should be "outnumber all the dancers", not just the set.
>< It's by no means impossible to be a good
>morris musician without being a dancer, but it's much harder...>
>Come off it. Musicians aren't a sub set of dancers. They have their own
>specialised skills.
>Dancers likewise.
You guys may not realize but all the orchestra members in the pit at Covent
Garden during a performance of Swan Lake are required to be ballet dancers
themselves. (otherwise how could they possibly play the music correctly?)
Or at least the conductor must be..
Or neither of the above.
-----
Nick Robertshaw | (301) 840 8604 (w) / ..... \
Frederick MD, | (301) 694 8820 (h) / ::::: \
ParaGlyph, Beyond what is carved in stone \ ..... /
FBMM, 4m'n \ ===== /
Capering Jeffries Duetist -----
________
Subject: Re: Morris team geography -- corrections solicited
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 15 May 1996 16:23:44 -0400
Content-Type: text/plain
>Based on responses to my geography query, I've decided to reorganize
>the U.K. section of my "All Known Morris-Related Web Pages" page as
>follows: U.K. broken down into countries (England and Wales, so far);
>England broken down into counties and unitary authorities; everything
>then sorted by city/town/village/region.
>
An alternative way of cataloging the sides might be:
Morris Teams broken down by county
Morris Teams broken down by sex
Morris Teams broken down by drink
Well, you get the picture.
-----
Nick Robertshaw | (301) 840 8604 (w) / ..... \
Frederick MD, | (301) 694 8820 (h) / ::::: \
ParGlyph, Beyond what is carved in stone \ ..... /
FBMM, 4m'n \ ===== /
Capering Jeffries Duetist -----
________
Subject: Re: Music-? (VMC - Vague Morris Content)
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Mon, 1 Apr 1996 09:08:47 -0500
Content-Type: text/plain
> I was recently at an event which, for the "banner Parade" [OM Teams
> entering the gym] they played a bunch of formal, fanfare-type classical
> march sort of processional music... when all of a sudden, I realized that
> the reason my feet wanted to dance was - it was Princess Royal! I tried,
> unsuccessfully, to track down what the music was. Anybody out there well-
> enough versed in classical music to know where Princess Royal would appear?
> If I manage to trace it elsewhere, I'll post it. Thanks
>
The 19th Century art song "The Arethusa" enterered the Classical repertoire
as part of a sea song medley (includes Tom Bowling and some others). I
believe the arranger was Sir Henry Wood. They became traditionally played
at the Last Night of the Proms, the final concert in the Promenade series
at London's Albert Hall each year.
And the tune for The Arethusa is Princess Royal. (Which is usually
attributed to O'Carolan, the Irish Harpist/composer).
--* Politicians are like diapers, they should be *--
--* changed regularly. And for the same reason *--
-----
Nick Robertshaw | (301) 840 5959 (w) / ..... \
Frederick MD, | (301) 694 8820 (h) / ::::: \
CAI/SISCo, | (301) 840 1859 (f) \ ..... /
Foggy Bottom Morris Men (4m'n) \ ===== /
Capering Jeffries Duet player -----
________
Subject: Re: here we go again
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Thu, 21 Mar 1996 09:17:17 -0500
Content-Type: text/plain
This has been a help in mapping out my plans for teaching the team in the
coming year.
We're going to work all spring and summer on the steps, the figures, and
the presentation.
Then in the fall we'll buckle down to darn well getting our conflation right.
Thanks to the acedemics for bringing this to my attention!
--* Politicians are like diapers, they should be *--
--* changed regularly. And for the same reason *--
-----
Nick Robertshaw | (301) 840 5959 (w) / ..... \
Frederick MD, | (301) 694 8820 (h) / ::::: \
CAI/SISCo, | (301) 840 1859 (f) \ ..... /
Foggy Bottom Morris Men (4m'n) \ ===== /
Capering Jeffries Duet player -----
________
ubject: Re: Processions, Cotswold and NW
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Mon, 11 Mar 1996 10:13:24 -0500
Content-Type: text/plain
...
>back to see ..... but suddenly, from between two cars, a startled fox
>appeared from across the road - and nipped straight across the set!
>Amazing. Thank you, Garstang - you made my year.
>
Sheesh. Are Garstang still bringing that bloody fox to all their performances?
--* Why not send a friend a singing mammogram? *--
-----
Nick Robertshaw | (301) 840 5959 (w) / ..... \
Frederick MD, | (301) 694 8820 (h) / ::::: \
CAI/SISCo, | (301) 840 1859 (f) \ ..... /
Foggy Bottom Morris Men (4m'n) \ ===== /
Capering Jeffries Duet player -----
________
Subject: Re: Women
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Thu, 29 Feb 1996 09:52:28 -0500
Content-Type: text/plain
Opined Morgy:
>> men had a pub culture (gathering for *purely* social pursuits *outside* the
bounds of work) while women's organised social pursuits often *involved*...
...
>>Husking bees were often unisex activities with song and games
This is nonsense. The men went to pub because they were sick of stepping
on all those bee husks.
________
Subject: Sweet F A; No M C
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 14 Feb 1996 08:53:17 -0500
Content-Type: text/plain
An old ditty:
Sweet Fanny Adams
Out to play
On the old apple tree in the orchard
She carved her name one day
The woodpecker came in springtime
And the woodpecker would peck away
So that all that was left on that old apple tree
Was Sweet
F
A
(From 'Songs I learned at my Mother's knee and other rough joints')
--* Why not send a friend a singing mammogram? *--
-----
Nick Robertshaw | (301) 840 5959 (w) / ..... \
Frederick MD, | (301) 694 8820 (h) / ::::: \
CAI/SISCo, | (301) 840 1859 (f) \ ..... /
Foggy Bottom Morris Men (4m'n) \ ===== /
Capering Jeffries Duet player -----
________
Subject: Sweeping Generalization du jour
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 7 Feb 1996 10:27:31 -0500
Content-Type: text/plain
From Ian Dedic's consolidated ripost:
>
>> Just the thing after a days hiking in Canyonlands, or
>> a Morris tour.
>
>QED. But why not during as well as after?
>
Because there are no pubs in Canyonlands.
Actually, there are no pubs in most of the US. This is much more of a
problem for a team than any perceived beer shortage. Some city areas have a
concentration of worthwhile bars (if HMM come east-side we'll be glad to
take you to Fell's Point Baltimore, a vibrant dockland), but for most part,
the 'burbs and rural areas are hopeless. I have NEVER
EVER
EVEN ONCE
AT ALL
found anything in the US remotely like a Village Pub.
A pox on puritans and prohibitionists!
--* Why not send a friend a singing mammogram? *--
-----
Nick Robertshaw | (301) 840 5959 (w) / ..... \
Frederick MD, | (301) 694 8820 (h) / ::::: \
CAI/SISCo, | (301) 840 1859 (f) \ ..... /
Foggy Bottom Morris Men (4m'n) \ ===== /
Capering Jeffries Duet player -----
________
Subject: Re: Utah Beer strength and taste (NMC)
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Tue, 6 Feb 1996 14:25:55 -0500
Content-Type: text/plain
>i.dedic@FML.CO.UK Writes...
>
>> The hardest task for a brewer is to brew a relatively weak beer.
>
>Obviously you've never drank the swill labeled beer here in Utah. It's
>not work the drinking for even the pleasure of falling over. Then again one
>has to export oneself to another state to do Morris as well.
>
Actually, one Utah brewpub produces a bitter that is close to
an English 'cooking', 'swilling' or 'session' beer. The place
(I forget its name) is in Moab (my washpot) Utah. State law restricts
beer strength to (I think) 3.5% a.b.v. and as a result they have to
focus on body and flavo(u)r to make something worth killing hops for.
They overcarbonate and overchill the resulting brew, as usual, but I
had a few pints once after they accidently forgot to do so and it was
very drinkable. Just the thing after a days hiking in Canyonlands, or
a Morris tour.
Moab is in Utah. Other than that they are different places.
--* Why not send a friend a singing mammogram? *--
-----
Nick Robertshaw | (301) 840 5959 (w) / ..... \
Frederick MD, | (301) 694 8820 (h) / ::::: \
CAI/SISCo, | (301) 840 1859 (f) \ ..... /
Foggy Bottom Morris Men (4m'n) \ ===== /
Capering Jeffries Duet player -----
________
Subject: Re: Beer, cheap and flying.
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Mon, 5 Feb 1996 10:18:22 -0500
Content-Type: text/plain
>cheapest beer in the UK is brewed by Joseph Holt in Manchester -- their bitter
>is delicious, closer in strength to most "special" bitters (about 4.1% I
>think),
>and last time I was in Manchester it was 99p a pint.
Well, the last time I had a pint of Bateman's Mild in Lincolnshire, it was 1/3d!
Of course, you could get a meal, a bed, and a wench for 'alf a crown in
them days too.
>
>P.P.P.S. Anyone know the customs/airline position on us bringing a barrel of
>Fuller's over as hand luggage?
I have brought over a poly-pin of Hook Norton on two occasions. The first
time it was admitted by customs to smiles of amusement. The second time,
they said that that I had exceeded my duty-free allowance of 1 liter and
made me pay about 35 bucks duty on the balance.
Beware of the behaviour of the container in flight. The beer got very
lively and I had to vent the barrel frequently. The resulting hissing
gurgle caused some alarm to to the cabin crew and other passengers.
--* Why not send a friend a singing mammogram? *--
-----
Nick Robertshaw | (301) 840 5959 (w) / ..... \
Frederick MD, | (301) 694 8820 (h) / ::::: \
CAI/SISCo, | (301) 840 1859 (f) \ ..... /
Foggy Bottom Morris Men (4m'n) \ ===== /
Capering Jeffries Duet player -----
________
Subject: PC Rapper team name origin language (36% MC)
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Mon, 29 Jan 1996 11:19:52 -0500
Content-Type: text/plain
So many fine threads, we should make the Emperor a new cummerbund.
Morgiana, the Brits have not caught up with PC. I can't even persuade my
dear old mum that 'negroes and negresses' actually prefer to be called
Blacks, Afams, or AmsofAfor. I vote we just call them people and move on.
Come to think of it, wasn't that what the pre-columbian Americans called
themselves too?
Will the Endangered Languages Act save the Northern Spotted Tongue?
Probably not. Our current languages are the victors of past linguistic
imperialism, colonialism, and vularism. The losers became threatened and
then ultimately extinct. Sad but inevitable.
The rapper team could use other 5-pointed/sided elements in its name
(Pentangle being associated with the Electric Muse in many minds).
"Pentacle" would nicely annoy the 'we are nothing to do with witchcraft or
Paganism' set.
Pentagon would underscore the defense electronics background of many 60s
and 70s era dance revivalists (Dommett himself worked in British Ministry
of Defence procurement).
Then there's the Quint suffix; the Cuisinart/blender meme; the
pony-scraping controversy; the ritual decapitiation link....
So call it Gangsta Rappa
--* Why not send a friend a singing mammogram? *--
-----
Nick Robertshaw | (301) 840 5959 (w) / ..... \
Frederick MD, | (301) 694 8820 (h) / ::::: \
CAI/SISCo, | (301) 840 1859 (f) \ ..... /
Foggy Bottom Morris, \ ===== /
Capering Jeffries Duet player -----
________
Subject:
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 17 Jan 1996 09:18:39 -0500
Content-Type: text/plain
>
>Let me kick the ball on this round by asking in anybody out there
>(especially in England) has a family member that has ever been in the Loyal
>Order of Oddfellows? If so, tell us about their cultural activities.
>
Well, I lived for 2 years in an Oddfellows Alms cottage (upgraded to a chic
suburban pied a terre) that was adjacent to a pub: The Oddfellows Arms. At
that time, my team (Herga Morris) practiced in an Oddfellows hall.
The affiliated Herga Folk club met at a pub called The Royal Oak (King
Charles connection here) in an upper room decorated by the Mooses (or Elks,
or Stoats?--help me here Bob Williams).
Most of us were thought of as odd fellows (although 'order' might be going
a little far).
Now what is it you'd like to prove Norman?
--* God, are you responsible for this? *--
-----
Nick Robertshaw | (301) 840 5959 (w) / ..... \
Frederick MD, | (301) 694 8820 (h) / ::::: \
CAI/SISCo, | (301) 840 1859 (f) \ ..... /
Foggy Bottom Morris, \ ===== /
Capering Jeffries Duet player -----
________
Subject: Re: More socially acceptable than......
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Mon, 8 Jan 1996 15:41:05 -0500
Content-Type: text/plain
Is this Morris vs Sex discussion intended to prepare us for the eventuality
of someone offering one the choice of one or the other (but not both)?
And if so does it presume that one would make that choice purely (or even
partly) on the basis of social acceptability?
Just wondering...
Nick (happy to offered either) Robertshaw
------------------ * Visualize Whirled Peas * ---------------
Nick Robertshaw _____
9314 Pear Lane / \
Frederick, MD 21702 / : : : \
(301) 840 5959 (w) (301) 694 8820 (h) \ : : : /
\ ===== /
"Playin all night, and the music's all right" -----
________
Subject: Accents, Englishness
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Fri, 17 Nov 1995 10:24:33 -0500
Content-Type: text/plain
1. It's not affected, I'm British
2. English people now think I sound like a Bloody Yank anyway
2. Real American Morris must be accompanied by an Englishman playing a
French Horn and a Frenchman playing a Cor Anglais
4. Appalachian Dulcimers may only be called Appalachian Dulcimers if
they're being played in Appalachia by Appalachians (Appaloosas don't count)
5. Same rule applies to Hammer Dulcimers.
Now that you all understand the rules please settle down out there.
--* There's nothing an agnostic can't do if he really *--
--* doesn't know whether he believes in anything or not. *--
-----
Nick Robertshaw | (301) 840 5959 (w) / ..... \
Frederick MD, | (301) 694 8820 (h) / ::::: \
CAI/SISCo, | (301) 840 1859 (f) \ ..... /
Foggy Bottom Morris, \ ===== /
Capering Jeffries Duet Monster -----
________
Subject: Re: Morris Web pages to get more visits
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Mon, 6 Nov 1995 10:00:39 -0500
Content-Type: text/plain
The URL for Rich's Morris page is
http://web.syr.edu/~rsholmes/morris/rich/index.html
>
>> The November issue of WIRED, the American magazine for people who keep kewl
>> and connected, gives a write up of our very own Rich Holmes' web site. For
>> those who have yet to surf over, Rich features Morris, Pratchett, and dead
>> people among other things.
>>
>> Rich also has links to morris and related pages all over the web so it
>> seems likely that these pages will see a surge of visitors. So if you have
>> a Morris Web page and you would like to recruit AOL clueless newbies this
>> month, make sure your links and contact info are up to date.
>>
>> --* There's nothing an agnostic can't do if he really *--
>> --* doesn't know whether he believes in anything or not. *--
>> -----
>> Nick Robertshaw | (301) 840 5959 (w) / ..... \
>> Frederick MD, | (301) 694 8820 (h) / ::::: \
>> CAI/SISCo, | (301) 840 1859 (f) \ ..... /
>> Foggy Bottom Morris, \ ===== /
>> Capering Jeffries Duet Monster -----
>>
--* There's nothing an agnostic can't do if he really *--
--* doesn't know whether he believes in anything or not. *--
-----
Nick Robertshaw | (301) 840 5959 (w) / ..... \
Frederick MD, | (301) 694 8820 (h) / ::::: \
CAI/SISCo, | (301) 840 1859 (f) \ ..... /
Foggy Bottom Morris, \ ===== /
Capering Jeffries Duet Monster -----
________
Subject: Morris Web pages to get more visits
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Fri, 3 Nov 1995 14:51:25 -0400
Content-Type: text/plain
The November issue of WIRED, the American magazine for people who keep kewl
and connected, gives a write up of our very own Rich Holmes' web site. For
those who have yet to surf over, Rich features Morris, Pratchett, and dead
people among other things.
Rich also has links to morris and related pages all over the web so it
seems likely that these pages will see a surge of visitors. So if you have
a Morris Web page and you would like to recruit AOL clueless newbies this
month, make sure your links and contact info are up to date.
--* There's nothing an agnostic can't do if he really *--
--* doesn't know whether he believes in anything or not. *--
-----
Nick Robertshaw | (301) 840 5959 (w) / ..... \
Frederick MD, | (301) 694 8820 (h) / ::::: \
CAI/SISCo, | (301) 840 1859 (f) \ ..... /
Foggy Bottom Morris, \ ===== /
Capering Jeffries Duet Monster -----
________
Subject: Terry Pratchett & Morris
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Tue, 10 Oct 1995 14:30:18 -0400
Content-Type: text/plain
Thanks to Rick Holmes' sig. line, my awareness of this author has been
awakened. For those who don't know, he (Terry, not Rich) is a British
writer of humorous (in a Douglas Adams vein) fantasy novels, notably the
Discworld series.
I noticed at least 2 references to him at the Bluemont ale: a dance name
and a T-shirt design (and I wasn't actually looking, since I was too busy
trying to recognize Elaine with her clothes on and to transport Bob Dupre
back to the 60s). I failed to record the details of either so...
Who has a dance in their repertoire (skit or otherwise) that makes
reference to a Discworld character?
c'mon, fess up.
And who had the T-shirt and where didja gettit.
And who else has Pratchettisms woven into the fabric of their dance?
--* No taste is too poor to be in *--
-----
Nick Robertshaw | (301) 840 5959 (w) / ..... \
Frederick MD, | (301) 694 8820 (h) / ::::: \
CAI/SISCo, | (301) 840 1859 (f) \ ..... /
Foggy Bottom Morris, \ ===== /
Capering Jeffries Duet Monster -----
________
Subject: Re: breaking up is hard to do?
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Thu, 14 Sep 1995 16:11:19 -0400
Content-Type: text/plain
>After all, there are fewer than 200 morris and sword teams in North
>America, very few of which, I would guess, resulted from a schism in
>the sense you're talking about. Each such schism took place in
>contexts and circumstances that were unique. Most probably were
>driven by issues of politics, ideology, and/or style preferences...
I witnessed 2 attempted morris schisms (in England, both resulted in 1 team).
In both cases the cause was one particular individual: a nice guy,
intitally well-liked by all, who became an agent-provocatuer in polarizing
the side over an unimportant (as it turned out) issue.
Some research into this individual's history revealed that he had left a
trail of schisms in his wake.
I consulted with some fellow observers of humankind and they each reported
instances of similar individuals.
I believe that this person had no malice or intention to calalyse a split,
it was just part of his personality to identify and exacerbate divisive
issues.
So, a warning. Schisms are often the work of professionals. Be on your guard.
--* Things are more like they used to be than they are now *--
-----
Nick Robertshaw | (301) 840 5959 (w) / ..... \
Frederick MD, | (301) 694 8820 (h) / ::::: \
CAI/SISCo, | (301) 840 1859 (f) \ ..... /
Foggy Bottom Morris, \ ===== /
Capering Jeffries Duet player -----
________
Subject: Re: Stone Circles
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Mon, 21 Aug 1995 15:14:10 -0500
Content-Type: text/plain
>
>1) I read somewhere it was the third most significant stone circle in
>Britain - the two most sig. being afore mentioned stone henge and Avebury.
>What makes a stone circle more significant than another?
Circles can get significant by being well connected. Avebury and Stonehenge
are both part of extensive local (some say national) systems of prehistoric
sites, including neolithic Longbarrows, cursuses, and other features that
lie on alleged Leys.
>
>and 2) (Here comes the morris connection as well) Did I read, hear or dream
>somewhere that someone had somehow made a morris/stone circle connection?
>If so what and how? I don't believe that such a connection exists but I would
>be interested to learn if anyone (Those strange Victorians I suspect) ever did
>try to link the two.
>
Many stone circles are linked with dance in legend. The most common
explanation for these circles is that they are dancers were turned to stone
by a tricksy devil who played late for them on Saturday and thus got them
petrified for dancing on the Sabbath. E.g. The Nine Maidens, near Penzance;
Castlerigg, Cumbria; Merry Maidens, nr Lamorna.
--* Things are more like they used to be than they are now *--
-----
Nick Robertshaw | (301) 840 5959 (w) / ..... \
Frederick MD, | (301) 694 8820 (h) / ::::: \
CAI/SISCo, | (301) 840 1859 (f) \ ..... /
Foggy Bottom Morris, \ ===== /
Capering Jeffries Duet player -----
________
Subject: Paula-Pauline
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Thu, 13 Jul 1995 15:08:10 -0500
Content-Type: text/plain
Sorry to to all the Paulas for mistakenly ascribing Pauline's
SPAM-mongering to you.
--* If it's racist, you're dancing too fast! *--
-----
Nick Robertshaw | (301) 840 5959 (w) / ..... \
Frederick MD, | (301) 694 8820 (h) / ::::: \
CAI/SISCo, | (301) 840 1859 (f) \ ..... /
Foggy Bottom Morris, \ ===== /
Capering Jeffries Duet player -----
________
Subject: Re: Morris, racism, FBMM Tour
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Thu, 13 Jul 1995 15:03:28 -0500
Content-Type: text/plain
Thanks for decoding Jon.
Having slogged through this tediousness I wish to make it clear that
I wish to avoid being branded as
"showing considerably greater sensitivity and insight."
(some chance, eh Bruce?)
I would also plead with the list to do all in their power to find
Paula a real job.
Perhaps then we can desist with the 'evilly banal constructions of [her]
scholarly project'
(was that reallly Elaine being evil and banal?) Way to go, Elaine!
SHUT UP AND DANCE!!
Alas, I must suspend my subscription to this list as I am about to leave
for a three-week trip to England, the first half of which I shall be much
too busy dancing to decide if it's racist or not. So be sure to cc me
directly if you have something really nasty to say. But I must leave others
to
supply the bloat of evil, insightful, banal, and sensitive guidance for Paula.
Should their patience fail them, they can come and fulminate at me and
the Foggy Bottom Morris Men (yes, men) at the following venues:
July 14th 9:30 pm on: The New Inn, Winterbourne Monkton, Wilts
July 15th 12:30 pm on: Avebury (just listen for the bells)
July 16th 11:30 am Old Sarum
1:00 pm: The Bridge, Upper Woodford
July 17th 7:00 pm: Coach and Horses, Longborough (thence on to Stow-on-the-Wold)
July 18th 7:00 pm: The Red Lion Brackley (thence on to Hinton)
July 19th 7:30 pm: The Watermans Arms, Osney Island (Oxford)
July 20th 7:30 pm: The Sow & Pigs, Toddington, Beds (thence round all the
other pubs)
July 21st 7:30 pm: The Shepherds Rest, South Marston, Wilts
July 22nd 12:00 pm: The Red Lion, Yardley Hastings, Northants
July 23rd 12:00 pm: The Coach and Horses, Kew Green
Many thanks to our host teams and all those who have helped put this tour
together:
Wild Hunt, Stroud, Sherborne, North Leigh, Old Spot?, Brackley,
Kirtlington, Icknield Way, Towersey, Redbournestoke, Bedford, Letchworth,
Whitchurch, Rose and Castle, Swindon, and Hammersmith. We owe you one;
we'll buy you one.
--* If it's racist, you're dancing too fast! *--
-----
Nick Robertshaw | (301) 840 5959 (w) / ..... \
Frederick MD, | (301) 694 8820 (h) / ::::: \
CAI/SISCo, | (301) 840 1859 (f) \ ..... /
Foggy Bottom Morris, \ ===== /
Capering Jeffries Duet player -----
________
Subject: The True origin of Morris Whites
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Tue, 11 Jul 1995 16:40:32 -0500
Content-Type: text/plain
>Norman Stanfield has said:
>>
>> So I ask you in England (or you ex-Brits living in exile), where are you in
>> this discussion? Are you just as puzzled as us? Or, are you scoffing at us
>> for being so ill-informed? Do you know the answer to this discussion, but
>> you prefer to lurk in the Net shadows, and watch us colonials make fools of
>> ourselves with our high-blown theories, extracted from other arm-chair
>> speculators? Or perhaps you find the question boring, bookishand
>> irrelevant, prefering to wait until something real gets asked on this
>> Listserve, like the correct way to do a galley?
>
All of the above, Norman.
Us ex-pats know that the true origin of Morris Whites is Marks and Spencers.
btw, galleys go clockwise in the northern hemisphere and counterclockwise
(hence widdershins) in the bottom half of the ball. (as viewed from above,
wherever that is).
--* Join the radical ultra-centerists! *--
-----
Nick Robertshaw | (301) 840 5959 (w) / ..... \
Frederick MD, | (301) 694 8820 (h) / ::::: \
CAI/SISCo, | (301) 840 1859 (f) \ ..... /
Foggy Bottom Morris, \ ===== /
Capering Jeffries Duet player -----
________
Subject: Re: MORRIS Digest - 4 Jul 1995 to 5 Jul 1995
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Thu, 6 Jul 1995 18:17:16 -0500
Content-Type: text/plain
>Point of Information:
>
>>Most of us do it sometime (didn't Jinky Wells'
>side do Albert's Hall?).<
>
>The Albert Hall isn't a conventional stage but ...
[one that Dr. Barrand endorses as OK ]
Nonetheless, it was the very antiseptic nature of the annual
EFDSS showcase at the Albert Hall that gave rise to the
Albert's In-town and Out-of-town Ceilidhs in London and Bath
on competing dates. (for those who preferred unprotected folking)
--* Join the radical ultra-centerists! *--
-----
Nick Robertshaw | (301) 840 5959 (w) / ..... \
Frederick MD, | (301) 694 8820 (h) / ::::: \
CAI/SISCo, | (301) 840 1859 (f) \ ..... /
Foggy Bottom Morris, \ ===== /
Capering Jeffries Duet player -----
________
Subject: Electric Processionals
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 5 Jul 1995 09:57:15 -0500
Content-Type: text/plain
The real challenge of electric processional dances is not so much the
amplification. After all, a decent-sized flat-bed lorry can carry the few
thousand watt amps and stacks and associated diesel generators.
No, the real problem is handling the effects pedals. Hitting the chorus,
flanger, compressor, equalizers, midi patch-changers and so-on at the right
time is tough enough when your standing but next to impossible when you're
processing. And the Wah-wah pedal is pretty much out the question so you're
almost forced to use the vocoder instead. (No technology should be spared
in the quest for preservation of tradition).
>amplification disrupts the communication between the dancers and the
>musician...
Dancers? Your team has dancers?
--* Join the radical ultra-centerists! *--
-----
Nick Robertshaw | (301) 840 5959 (w) / ..... \
Frederick MD, | (301) 694 8820 (h) / ::::: \
CAI/SISCo, | (301) 840 1859 (f) \ ..... /
Foggy Bottom Morris, \ ===== /
Capering Jeffries Duet player -----
________
Subject: Re: Electric Instruments
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Mon, 3 Jul 1995 09:42:03 -0500
Content-Type: text/plain
>I can see that electronics are just as contoversial now as when I was using
>them in the mid-80's.
It seems that one of the quarrels against amplification is that it alters
the balance of power between the dancers and musician.
So we need to amplify the bells and sticks too, and perhaps the panting and
little grunting noises during the capers.
--* Join the radical ultra-centerists! *--
-----
Nick Robertshaw | (301) 840 5959 (w) / ..... \
Frederick MD, | (301) 694 8820 (h) / ::::: \
CAI/SISCo, | (301) 840 1859 (f) \ ..... /
Foggy Bottom Morris, \ ===== /
Capering Jeffries Duet player -----
________
Subject: Sexy women dancers
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Wed, 28 Jun 1995 15:04:32 -0500
Content-Type: text/plain
Elaine asks if we morris men find morris women sexy.
Well, actually, we try not think about it because it changes our center of
gravity and upsets our dancing. And while we're on the subject, let's
dispel that old myth about men not being able to think of more than one
thing at a time.
Men are always thinking of at least two things; 1. Sex, and 2. er, whatever
it was you were just talking about.
--* Join the radical ultra-centerists! *--
-----
Nick Robertshaw | (301) 840 5959 (w) / ..... \
Frederick MD, | (301) 694 8820 (h) / ::::: \
CAI/SISCo, | (301) 840 1859 (f) \ ..... /
Foggy Bottom Morris, \ ===== /
Capering Jeffries Duet player -----
________
Subject: Handbags is it? Enraged Morrisman!!
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Fri, 23 Jun 1995 10:18:21 -0500
Content-Type: text/plain
I was virtually listening to your show on the Internet this morning and
word has come to these shores of your foolish quip casting aspersions
on the sexual preferences of morrismen. Don't pretend it wasn't what you
meant. Enough that you poked fun at Dallas and Brocolli Spears but now
you start in on an ancient and hallowed English tradition. How would you like
it if someone implied that Irish step dancers were all butch old harridans.
Get educated. Stand in the street when Garstang or the Bedlams come on and
I'll wager that any utterances of 'handbags' will seem to you about as
appropriate as they would be applied to an SAS assault team.
Thankfully you pollution of the aether is sufficiently attenuated by the
atmosphere not to make over the Atlantic.
Your former listener,
Enraged, large, strong, and securely heterosexual.
--* Join the radical ultra-centerists! *--
-----
Nick Robertshaw | (301) 840 5959 (w) / ..... \
Frederick MD, | (301) 694 8820 (h) / ::::: \
CAI/SISCo, | (301) 840 1859 (f) \ ..... /
Foggy Bottom Morris, \ ===== /
Capering Jeffries Duet player -----
________
Subject: Re: Dutch
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Thu, 15 Jun 1995 14:31:44 -0500
Content-Type: text/plain
Says Mark Rogers...
>Incedentally, when on a tour with Spring Grove MM / More Motley Morris of
>Eindhoven a few years ago (in the Netherlands), I came across a
>traditional Dutch (not for tourists) dance group called something like
>"Morrisco Morrisca" - named after an old Dutch childrens song. I asked
>what it meant, and was told that it was gibberish!
>
Aha!. Gibberish is, of course the native language of Gibraltar. This must
have been the route that the Moors took from Africa through Spain (and
Spitaly) on their way to misrule the Cotswolds, Holland, and Romania.
Well done. The final piece of the puzzle falls elegantly into place.
No, wait. Where did they pick up the goat?
--* Without priests, there'd be no sinners *--
-----
Nick Robertshaw | (301) 840 5959 (w) / ..... \
Frederick MD, | (301) 694 8820 (h) / ::::: \
CAI/SISCo, | (301) 840 1859 (f) \ ..... /
Foggy Bottom Morris, \ ===== /
Capering Jeffries Duet player -----
________
Subject: Gig needed, July 21, UK
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Tue, 30 May 1995 15:45:36 -0500
Content-Type: text/plain
The Foggy Bottom Morris British Tour of 1995 finds itself gigless
for the evening of Friday July 21st (our original plans having
foundered on the rocks of a not-to-be mentioned team that are
unable to field a side anymore)
We will be in the Northamptonshire-Oxfordshire area (could stretch to
Cambs Bucks or Beds) and would appreciate any leads on the following:
-- A side to dance out with at a couple of pubs
-- A Ceilidh
-- A traditional or music-hall song club
-- wakes, fairs, bearbaitings, orgies....
Reply by direct Email and I will reveal the true identity of
The Longsword Side from Hell.
Thanksalot
--* Beware of Geeks bearing GIFs *--
-----
Nick Robertshaw | (301) 840 5959 (w) / ..... \
Frederick MD, | (301) 694 8820 (h) / ::::: \
CAI/SISCo, | (301) 840 1859 (f) \ ..... /
Foggy Bottom Morris, \ ===== /
Capering Jeffries Duet player -----
________
Subject: Elsie Marley
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Tue, 23 May 1995 09:14:55 -0500
Content-Type: text/plain
da woyds: (garnered as usual in the Digital Traditions database, aka
http://web2.xerox.com/digitrad/titles)
Elsie Marley
chorus: Di' ye ken Elsie Marley, honey
The wife that sells the barley,honey
She lost her pocket and all her money
A-back o' the bush in the garden, honey
Elsie Marley's grown so fine
She won't get up to serve the swine
But lies in bed till eight or nine
And surely she does take her time.
Elsie Marley is so neat
It's hard for one to walk the street
But every lad and lass they meet
Cries "Di' ye ken Elsie Marley, honey?"
Elsie Marley wore a straw hat
But now she's getten a velvet cap
The Lambton lads mun pay for that
Di' ye ken Elsie Marley, honey?
Elsie keeps rum, gin and ale
In her house below the dale
Where every tradesman, up and down
Does call and spend his half-a-crown.
The farmers as they cum that way
They drink with Elsie every day
And call the fiddler for to play
The tune of Elsie Marley, honey.
The pitmen and the keelmen trim
They drink Bumbo made of gin
And for to dance they do begin
To the tune of Elsie Marley, honey.
Those gentlemen who go so fine
They'll treat her with a bottle of wine
And freely they'll sit down and dine
Along with Elsie Marley, honey.
So to conclude those lines I've penn'd
Hoping there's none I do offend
And thus my merry joke does end
Concerning Elsie Marley, honey.
from Songs of Northern England, Stokoe
Note: mentioned in Byker Hill
@drink
filename[ ELSMARLY
play.exe ELSMARLY
RG
--* If you're not touching, it doesn't matter who's on top *--
-----
Nick Robertshaw | (301) 840 5959 (w) / ..... \
Frederick MD, | (301) 694 8820 (h) / ::::: \
CAI/SISCo, | (301) 840 1859 (f) \ ..... /
Foggy Bottom Morris, \ ===== /
Capering Jeffries Duet player -----
________
Subject: SUN (and other things) UP, ONE MORE TIME
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Mon, 8 May 1995 10:44:30 -0500
Content-Type: text/plain
> well, now that everyone else has said their piece on mayday,
> it's time for groans as i describe the quaint tradition (oops?) of
> the fabulous Foggy Bottom Morris Men, of dancing on--Mayday
> (Observed). this IS our seat of government, after all (and steve
> corrsin can't deny it).
Thankyou sharon. I must add that it is also Foggy Bottom's (and Rock
Creek's) special duty, as the Resident Team of Our Nations Capital and
therefore the Morris Leaders of the Free World, to ensure that the
Wa(r)shington Monument, that Great Symbol of American Manhood, stands proud
and erect for another year. Anyone who visits DC in late April might notice
that the WM starts to appear slightly flaccid. Be assured that condition
has now been erectified.
Oh, and when *we* danced the sun up, it stayed up all day. Bright, clear,
warm sunlight. Thanks to all the other teams who pre-conditioned it last
week.
--* If you're not touching, it doesn't matter who's on top *--
-----
Nick Robertshaw | (301) 840 5959 (w) / ..... \
Frederick MD, | (301) 694 8820 (h) / ::::: \
CAI/SISCo, | (301) 840 1859 (f) \ ..... /
Foggy Bottom Morris, \ ===== /
Capering Jeffries Duet player -----
________
Subject: Writ: You all Dance
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Mon, 8 May 1995 10:17:44 -0500
Content-Type: text/plain
Quoth elaine:
>Hey Rich, I think Ritual is an uncomfortable term at best, having met a
>women who does actually dance for seriously religious purposes (and calls
>it ritual dance). What term should we use instead? Ceremonial's not much
>better and spectacular might be pushing it too. When I think of
>spectacular dance, I think of professional Russion Folk Dance troupes
>hurling themselves through the air.
>Would love to hear some ideas on this one
>elaine
Hmm. I witnessed a group of people who were adding dance to a religeous
event, the program described it as 'liturgical dance'. I was reminded of
the King in Amadeus who turns to the chaimberlain with a puzzled expression
and inquires: "is it modern?"
So tell your friend to call it something else. She's interfering with our
goal of a language of perfectly defined and consistently applied words.
Surely idea of employing a dictionary to arbitrate on the meaning and
nuance of a word is folly. Even (!) the OED's definitions are terse and
restrictive in order to keep its size down to a manageable 20 feet of shelf
space. Encyclopedias might be a better place to look but a real one has
never been written (it would need several pages of text and pictures for
each word in the OED.) So all that's left to define our meaning of 'ritual'
is our usage. And in our context it simply means rapper, Cotswold, Molly,
Border and Northwest with nuances of ceremony, tradition, mystery, misrule
(drunkenness, rowdiness, running off with someone to take advantage of the
fact that you're already hot, high, and sweaty).
"When I use a word," said Humpty Dumpty...
--* If you're not touching, it doesn't matter who's on top *--
-----
Nick Robertshaw | (301) 840 5959 (w) / ..... \
Frederick MD, | (301) 694 8820 (h) / ::::: \
CAI/SISCo, | (301) 840 1859 (f) \ ..... /
Foggy Bottom Morris, \ ===== /
Capering Jeffries Duet player -----
________
Subject: Re: Gr'Ale & History
From: Nick Robertshaw <[log in to unmask]>
Reply-To: Nick Robertshaw <[log in to unmask]>
Date: Thu, 27 Apr 1995 12:00:56 -0500
Content-Type: text/plain
>(Arbeau (Pg. 2)..... "you must realize that a mistress is won
^^^^^^^^
>by good temper and grace displayed while dancing....
Yeah, but who's allowed a mistress these days?
--* If you're not touching, it doesn't matter who's on top *--
-----
Nick Robertshaw | (301) 840 5959 (w) / ..... \
Frederick MD, | (301) 694 8820 (h) / ::::: \
CAI/SISCo, | (301) 840 1859 (f) \ ..... /
Foggy Bottom Morris, \ ===== /
Capering Jeffries Duet player -----
________
Comments (1)
David Barnert said
at 10:43 pm on Nov 8, 2007
Jim-- Is there a way to make the text on this page appear in a monospaced font? Some of the earliest posts (from 1995 and 96) contain an "ASCII art" image of a concertina that is ruined by the proportional font on this page. I remember laughing out loud when I first saw it on the MDDL back then. It inspired my own ASCII sig with the concertina bellows and the ventilator bellows. -- David Barnert
You don't have permission to comment on this page.